FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629165_at:

>probe:Drosophila_2:1629165_at:698:23; Interrogation_Position=1506; Antisense; ATAGCTTCCACGAGGCGAAACGCTT
>probe:Drosophila_2:1629165_at:609:199; Interrogation_Position=1524; Antisense; AACGCTTTCTGCGTGAAACTCTGAA
>probe:Drosophila_2:1629165_at:625:119; Interrogation_Position=1583; Antisense; AGCTGCTCGTTGGTTTTGCTATCGC
>probe:Drosophila_2:1629165_at:401:353; Interrogation_Position=1606; Antisense; GCACGTCTTTCTCAGCATCGGAAAC
>probe:Drosophila_2:1629165_at:192:209; Interrogation_Position=1639; Antisense; AAGCATGAACATGGTGACGCCGGCC
>probe:Drosophila_2:1629165_at:311:197; Interrogation_Position=1668; Antisense; AACTGGCCAGTAAGATACCCGACAT
>probe:Drosophila_2:1629165_at:302:169; Interrogation_Position=1723; Antisense; AAAGGACCTGCATCGTATGTCAAAG
>probe:Drosophila_2:1629165_at:340:99; Interrogation_Position=1765; Antisense; AGATGCTTATGCTAACCACGTTAAA
>probe:Drosophila_2:1629165_at:391:241; Interrogation_Position=1788; Antisense; AATACTCGGAGAACCTGATTGCAGA
>probe:Drosophila_2:1629165_at:502:463; Interrogation_Position=1804; Antisense; GATTGCAGACCAGCGCAAGTGCGTC
>probe:Drosophila_2:1629165_at:435:171; Interrogation_Position=1830; Antisense; AAAGTGCGCATCACGAACTCGTCAA
>probe:Drosophila_2:1629165_at:414:193; Interrogation_Position=1845; Antisense; AACTCGTCAACTGGTTCCAGGGCGA
>probe:Drosophila_2:1629165_at:330:447; Interrogation_Position=1982; Antisense; GGGCAATACGGTCAGTTCTACTAGC
>probe:Drosophila_2:1629165_at:17:17; Interrogation_Position=2042; Antisense; ATTTTTATCTACGACCTAGCGACTA

Paste this into a BLAST search page for me
ATAGCTTCCACGAGGCGAAACGCTTAACGCTTTCTGCGTGAAACTCTGAAAGCTGCTCGTTGGTTTTGCTATCGCGCACGTCTTTCTCAGCATCGGAAACAAGCATGAACATGGTGACGCCGGCCAACTGGCCAGTAAGATACCCGACATAAAGGACCTGCATCGTATGTCAAAGAGATGCTTATGCTAACCACGTTAAAAATACTCGGAGAACCTGATTGCAGAGATTGCAGACCAGCGCAAGTGCGTCAAAGTGCGCATCACGAACTCGTCAAAACTCGTCAACTGGTTCCAGGGCGAGGGCAATACGGTCAGTTCTACTAGCATTTTTATCTACGACCTAGCGACTA

Full Affymetrix probeset data:

Annotations for 1629165_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720