FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629167_at:

>probe:Drosophila_2:1629167_at:127:109; Interrogation_Position=1735; Antisense; AGAAGCCTCGCGATAGACCCTGGGA
>probe:Drosophila_2:1629167_at:400:541; Interrogation_Position=1757; Antisense; GGATTTAAGTATCGAGACCCTGCGT
>probe:Drosophila_2:1629167_at:91:413; Interrogation_Position=1772; Antisense; GACCCTGCGTCACTTTATTGGCAAG
>probe:Drosophila_2:1629167_at:77:77; Interrogation_Position=1798; Antisense; AGGAGAGTCGCTTCCTGCGCGAGAA
>probe:Drosophila_2:1629167_at:26:591; Interrogation_Position=1837; Antisense; TGGTTGCTTTGCTCCAGCCGATGAA
>probe:Drosophila_2:1629167_at:699:533; Interrogation_Position=1870; Antisense; GGTGCTCAGCTTATCCCTTAATGGA
>probe:Drosophila_2:1629167_at:648:457; Interrogation_Position=1911; Antisense; GATAGATCCCGCTTCATTTACGTGC
>probe:Drosophila_2:1629167_at:380:93; Interrogation_Position=1996; Antisense; AGTTCTTTAAGCTGGAGCTCCTCCA
>probe:Drosophila_2:1629167_at:272:375; Interrogation_Position=2069; Antisense; GAAGAATCGCCAGCAGGGTCCAGAT
>probe:Drosophila_2:1629167_at:640:487; Interrogation_Position=2150; Antisense; GTACCTCAAGGACTCTCTCTATATG
>probe:Drosophila_2:1629167_at:499:643; Interrogation_Position=2165; Antisense; TCTCTATATGCACACCTACAGTCTG
>probe:Drosophila_2:1629167_at:99:337; Interrogation_Position=2189; Antisense; GCTCTGTGATGCTGCCGAGGACATA
>probe:Drosophila_2:1629167_at:703:437; Interrogation_Position=2205; Antisense; GAGGACATAGTCTCCGTCATCGAAA
>probe:Drosophila_2:1629167_at:242:603; Interrogation_Position=2237; Antisense; TGATTAGCATTCACAACACCCTTTC

Paste this into a BLAST search page for me
AGAAGCCTCGCGATAGACCCTGGGAGGATTTAAGTATCGAGACCCTGCGTGACCCTGCGTCACTTTATTGGCAAGAGGAGAGTCGCTTCCTGCGCGAGAATGGTTGCTTTGCTCCAGCCGATGAAGGTGCTCAGCTTATCCCTTAATGGAGATAGATCCCGCTTCATTTACGTGCAGTTCTTTAAGCTGGAGCTCCTCCAGAAGAATCGCCAGCAGGGTCCAGATGTACCTCAAGGACTCTCTCTATATGTCTCTATATGCACACCTACAGTCTGGCTCTGTGATGCTGCCGAGGACATAGAGGACATAGTCTCCGTCATCGAAATGATTAGCATTCACAACACCCTTTC

Full Affymetrix probeset data:

Annotations for 1629167_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720