FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629173_at:

>probe:Drosophila_2:1629173_at:515:107; Interrogation_Position=358; Antisense; AGAACGACCCGCTAATCGAGAGCTT
>probe:Drosophila_2:1629173_at:583:425; Interrogation_Position=375; Antisense; GAGAGCTTCAACTCGATGTATCGCA
>probe:Drosophila_2:1629173_at:3:565; Interrogation_Position=404; Antisense; GGAATACCTTAAAGCCACCTGCATA
>probe:Drosophila_2:1629173_at:29:405; Interrogation_Position=454; Antisense; GACTCACCTGGTACATCAATGGCGA
>probe:Drosophila_2:1629173_at:40:705; Interrogation_Position=489; Antisense; TTAGGCGAACTGTATCCCACAACGG
>probe:Drosophila_2:1629173_at:716:195; Interrogation_Position=509; Antisense; AACGGACACAAGTTTGGCGGCCCAT
>probe:Drosophila_2:1629173_at:422:725; Interrogation_Position=522; Antisense; TTGGCGGCCCATGATTATGTACTGA
>probe:Drosophila_2:1629173_at:17:157; Interrogation_Position=551; Antisense; ACAGCGGCTTCAGGTGCAATTCTTT
>probe:Drosophila_2:1629173_at:497:235; Interrogation_Position=608; Antisense; AATCCTGGAGCTCAAATGCGTTGCG
>probe:Drosophila_2:1629173_at:603:181; Interrogation_Position=640; Antisense; AAAATTATCCGGAGCTGAGGCGCGA
>probe:Drosophila_2:1629173_at:712:367; Interrogation_Position=731; Antisense; GAATGCAAACTCTGGCTCGGCACAA
>probe:Drosophila_2:1629173_at:415:349; Interrogation_Position=772; Antisense; GCAGGACGTCACTAATTTCCGCATT
>probe:Drosophila_2:1629173_at:655:9; Interrogation_Position=794; Antisense; ATTCCTGGCGGCAATTCTACTAATT
>probe:Drosophila_2:1629173_at:701:277; Interrogation_Position=810; Antisense; CTACTAATTCACTGTTTGCGACGCC

Paste this into a BLAST search page for me
AGAACGACCCGCTAATCGAGAGCTTGAGAGCTTCAACTCGATGTATCGCAGGAATACCTTAAAGCCACCTGCATAGACTCACCTGGTACATCAATGGCGATTAGGCGAACTGTATCCCACAACGGAACGGACACAAGTTTGGCGGCCCATTTGGCGGCCCATGATTATGTACTGAACAGCGGCTTCAGGTGCAATTCTTTAATCCTGGAGCTCAAATGCGTTGCGAAAATTATCCGGAGCTGAGGCGCGAGAATGCAAACTCTGGCTCGGCACAAGCAGGACGTCACTAATTTCCGCATTATTCCTGGCGGCAATTCTACTAATTCTACTAATTCACTGTTTGCGACGCC

Full Affymetrix probeset data:

Annotations for 1629173_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720