FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629174_at:

>probe:Drosophila_2:1629174_at:34:207; Interrogation_Position=1048; Antisense; AAGCGAACCGCCAAGGATCTCAAAG
>probe:Drosophila_2:1629174_at:329:207; Interrogation_Position=1103; Antisense; AAGCGGACATACTACGCCTGCAGGA
>probe:Drosophila_2:1629174_at:318:195; Interrogation_Position=555; Antisense; AACTGCTAGAGATGTCTCGCTCCAA
>probe:Drosophila_2:1629174_at:597:185; Interrogation_Position=592; Antisense; AACAATGCGGCCGAGATCGATCGAT
>probe:Drosophila_2:1629174_at:471:269; Interrogation_Position=621; Antisense; CATGGCACAGGCAGTTATTGGCTAC
>probe:Drosophila_2:1629174_at:389:691; Interrogation_Position=636; Antisense; TATTGGCTACGATCACATCCTGGAC
>probe:Drosophila_2:1629174_at:556:685; Interrogation_Position=684; Antisense; TATAACAGATGTGGTGCAGTCCCGA
>probe:Drosophila_2:1629174_at:216:297; Interrogation_Position=706; Antisense; CGACAGAACGCTGCTCTTGGAGAGT
>probe:Drosophila_2:1629174_at:325:429; Interrogation_Position=727; Antisense; GAGTTCCTGGCCAACCTTAAGGCAT
>probe:Drosophila_2:1629174_at:117:565; Interrogation_Position=756; Antisense; GGAATCTCGCGAAGAGCTGCATCAA
>probe:Drosophila_2:1629174_at:129:541; Interrogation_Position=810; Antisense; GGTTGAGTTGACCAATGTTGCCAAT
>probe:Drosophila_2:1629174_at:380:383; Interrogation_Position=858; Antisense; GAACTATTATGGTCGAACCGCCCTG
>probe:Drosophila_2:1629174_at:592:589; Interrogation_Position=926; Antisense; TGGTGAAAATCTGTCCCGAGGGCTT
>probe:Drosophila_2:1629174_at:145:143; Interrogation_Position=976; Antisense; ACTGTTCTGCATTACGCCATGGGTA

Paste this into a BLAST search page for me
AAGCGAACCGCCAAGGATCTCAAAGAAGCGGACATACTACGCCTGCAGGAAACTGCTAGAGATGTCTCGCTCCAAAACAATGCGGCCGAGATCGATCGATCATGGCACAGGCAGTTATTGGCTACTATTGGCTACGATCACATCCTGGACTATAACAGATGTGGTGCAGTCCCGACGACAGAACGCTGCTCTTGGAGAGTGAGTTCCTGGCCAACCTTAAGGCATGGAATCTCGCGAAGAGCTGCATCAAGGTTGAGTTGACCAATGTTGCCAATGAACTATTATGGTCGAACCGCCCTGTGGTGAAAATCTGTCCCGAGGGCTTACTGTTCTGCATTACGCCATGGGTA

Full Affymetrix probeset data:

Annotations for 1629174_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720