FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629176_at:

>probe:Drosophila_2:1629176_at:623:229; Interrogation_Position=1002; Antisense; AATGGGCCCCATCTGGCTGCGATGA
>probe:Drosophila_2:1629176_at:312:243; Interrogation_Position=1029; Antisense; AATTTGCCCGCCTCCGTGAAAGTGG
>probe:Drosophila_2:1629176_at:712:617; Interrogation_Position=1060; Antisense; TGCAGGCGGGCCATGAGTTCATCTA
>probe:Drosophila_2:1629176_at:666:57; Interrogation_Position=1072; Antisense; ATGAGTTCATCTACACGCACCAGGA
>probe:Drosophila_2:1629176_at:338:601; Interrogation_Position=1104; Antisense; TCTCGCCTAACTGATGCCGTTTGGA
>probe:Drosophila_2:1629176_at:496:479; Interrogation_Position=1122; Antisense; GTTTGGACCGATGATAGCACCCTCA
>probe:Drosophila_2:1629176_at:673:269; Interrogation_Position=1145; Antisense; CATCACCATTGGACATGGCCGCAAA
>probe:Drosophila_2:1629176_at:626:581; Interrogation_Position=1160; Antisense; TGGCCGCAAAATGGTGACGCACGCT
>probe:Drosophila_2:1629176_at:556:19; Interrogation_Position=734; Antisense; ATTTGTGACCTGTGATCGTGGCGGC
>probe:Drosophila_2:1629176_at:583:625; Interrogation_Position=860; Antisense; TGCCTCGGAGCTGCAGGGTGACAAT
>probe:Drosophila_2:1629176_at:126:533; Interrogation_Position=875; Antisense; GGGTGACAATCACATCTATCTCGGG
>probe:Drosophila_2:1629176_at:296:611; Interrogation_Position=905; Antisense; TGACGGCAAAGTTCATACTCTGGAC
>probe:Drosophila_2:1629176_at:587:669; Interrogation_Position=920; Antisense; TACTCTGGACATTCGAGTGCCACGA
>probe:Drosophila_2:1629176_at:472:579; Interrogation_Position=978; Antisense; GGCCATGTCGCCCAGTTATTAATCA

Paste this into a BLAST search page for me
AATGGGCCCCATCTGGCTGCGATGAAATTTGCCCGCCTCCGTGAAAGTGGTGCAGGCGGGCCATGAGTTCATCTAATGAGTTCATCTACACGCACCAGGATCTCGCCTAACTGATGCCGTTTGGAGTTTGGACCGATGATAGCACCCTCACATCACCATTGGACATGGCCGCAAATGGCCGCAAAATGGTGACGCACGCTATTTGTGACCTGTGATCGTGGCGGCTGCCTCGGAGCTGCAGGGTGACAATGGGTGACAATCACATCTATCTCGGGTGACGGCAAAGTTCATACTCTGGACTACTCTGGACATTCGAGTGCCACGAGGCCATGTCGCCCAGTTATTAATCA

Full Affymetrix probeset data:

Annotations for 1629176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720