Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629179_at:

>probe:Drosophila_2:1629179_at:145:645; Interrogation_Position=2250; Antisense; TCATCTCTTCAACGACGGTGGTGGA
>probe:Drosophila_2:1629179_at:614:255; Interrogation_Position=2307; Antisense; CAAAGGTCTGATTGCCCGAGGAAAA
>probe:Drosophila_2:1629179_at:326:561; Interrogation_Position=2326; Antisense; GGAAAACTTTACCTCATTCTCGATT
>probe:Drosophila_2:1629179_at:83:647; Interrogation_Position=2339; Antisense; TCATTCTCGATTCCGCGACAGATGG
>probe:Drosophila_2:1629179_at:266:175; Interrogation_Position=2459; Antisense; AATCCCTTCCCGACTTTAATGATCT
>probe:Drosophila_2:1629179_at:20:699; Interrogation_Position=2473; Antisense; TTTAATGATCTTCCGCAATCCGTTC
>probe:Drosophila_2:1629179_at:116:651; Interrogation_Position=2504; Antisense; TCACCCTGGAATTCTTCTCAGAGCA
>probe:Drosophila_2:1629179_at:460:693; Interrogation_Position=2535; Antisense; TTTGATCCGCTTTGAACACTTCTTG
>probe:Drosophila_2:1629179_at:637:687; Interrogation_Position=2603; Antisense; TATTCGATAGTCTTGGCGGTTTGGC
>probe:Drosophila_2:1629179_at:278:205; Interrogation_Position=2674; Antisense; AAGCGATTCAAGTTCCATGCACAAG
>probe:Drosophila_2:1629179_at:49:203; Interrogation_Position=2706; Antisense; AACCAAGCCGTCATCCGTGGAATAT
>probe:Drosophila_2:1629179_at:343:585; Interrogation_Position=2723; Antisense; TGGAATATTCTACGGCACAGCACAA
>probe:Drosophila_2:1629179_at:552:599; Interrogation_Position=2760; Antisense; TGTCAAATCGGATGAGGCCTCACTT
>probe:Drosophila_2:1629179_at:412:315; Interrogation_Position=2776; Antisense; GCCTCACTTTTTGCTGTAACACTAT

Paste this into a BLAST search page for me
TCATCTCTTCAACGACGGTGGTGGACAAAGGTCTGATTGCCCGAGGAAAAGGAAAACTTTACCTCATTCTCGATTTCATTCTCGATTCCGCGACAGATGGAATCCCTTCCCGACTTTAATGATCTTTTAATGATCTTCCGCAATCCGTTCTCACCCTGGAATTCTTCTCAGAGCATTTGATCCGCTTTGAACACTTCTTGTATTCGATAGTCTTGGCGGTTTGGCAAGCGATTCAAGTTCCATGCACAAGAACCAAGCCGTCATCCGTGGAATATTGGAATATTCTACGGCACAGCACAATGTCAAATCGGATGAGGCCTCACTTGCCTCACTTTTTGCTGTAACACTAT

Full Affymetrix probeset data:

Annotations for 1629179_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime