FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629180_at:

>probe:Drosophila_2:1629180_at:478:335; Interrogation_Position=1551; Antisense; GCTGCTGCGCGGGTTTAACATGACC
>probe:Drosophila_2:1629180_at:70:661; Interrogation_Position=1566; Antisense; TAACATGACCACAGTGTTCCTGGCC
>probe:Drosophila_2:1629180_at:168:611; Interrogation_Position=1593; Antisense; TGACGCCACGCCATACGAGCTGATG
>probe:Drosophila_2:1629180_at:660:559; Interrogation_Position=1617; Antisense; GGAACTAAAGGAGCTCTTCTACCGC
>probe:Drosophila_2:1629180_at:586:321; Interrogation_Position=1660; Antisense; GCGCCGGAGTCGAATGTCCAACGAA
>probe:Drosophila_2:1629180_at:426:595; Interrogation_Position=1749; Antisense; TGTGGGCACCTACGAGAGCACCTTC
>probe:Drosophila_2:1629180_at:172:711; Interrogation_Position=1771; Antisense; TTCACGTACCGCATCTACGAGGAGC
>probe:Drosophila_2:1629180_at:526:75; Interrogation_Position=1790; Antisense; AGGAGCGCGAGATCCTCGGCTTTAC
>probe:Drosophila_2:1629180_at:421:69; Interrogation_Position=1817; Antisense; AGGCCAGCACCTTTAACACGTTCTG
>probe:Drosophila_2:1629180_at:332:661; Interrogation_Position=1830; Antisense; TAACACGTTCTGCAAGGCCTTAGGC
>probe:Drosophila_2:1629180_at:148:439; Interrogation_Position=1915; Antisense; GAGGAAGATTCCGACCCGTACTGAT
>probe:Drosophila_2:1629180_at:78:131; Interrogation_Position=1955; Antisense; ACCTGACATCTCAAGACCTAGTTTT
>probe:Drosophila_2:1629180_at:546:421; Interrogation_Position=2001; Antisense; GAGCAAACGGGATTCCGAACCACCT
>probe:Drosophila_2:1629180_at:135:381; Interrogation_Position=2017; Antisense; GAACCACCTGCGATTGTGTACCAAA

Paste this into a BLAST search page for me
GCTGCTGCGCGGGTTTAACATGACCTAACATGACCACAGTGTTCCTGGCCTGACGCCACGCCATACGAGCTGATGGGAACTAAAGGAGCTCTTCTACCGCGCGCCGGAGTCGAATGTCCAACGAATGTGGGCACCTACGAGAGCACCTTCTTCACGTACCGCATCTACGAGGAGCAGGAGCGCGAGATCCTCGGCTTTACAGGCCAGCACCTTTAACACGTTCTGTAACACGTTCTGCAAGGCCTTAGGCGAGGAAGATTCCGACCCGTACTGATACCTGACATCTCAAGACCTAGTTTTGAGCAAACGGGATTCCGAACCACCTGAACCACCTGCGATTGTGTACCAAA

Full Affymetrix probeset data:

Annotations for 1629180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720