FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629181_at:

>probe:Drosophila_2:1629181_at:206:107; Interrogation_Position=272; Antisense; AGAAACTCAGACAATCCTACGATTA
>probe:Drosophila_2:1629181_at:29:157; Interrogation_Position=308; Antisense; ACAATCCCCTCTATGGGTAACCAGT
>probe:Drosophila_2:1629181_at:127:493; Interrogation_Position=324; Antisense; GTAACCAGTTCCAAAGTCCACTTAG
>probe:Drosophila_2:1629181_at:212:219; Interrogation_Position=337; Antisense; AAGTCCACTTAGTCTTTGCTCTCGA
>probe:Drosophila_2:1629181_at:371:679; Interrogation_Position=346; Antisense; TAGTCTTTGCTCTCGAATCGGTCAT
>probe:Drosophila_2:1629181_at:656:365; Interrogation_Position=360; Antisense; GAATCGGTCATCCAAGCCTTTGAGA
>probe:Drosophila_2:1629181_at:451:465; Interrogation_Position=474; Antisense; GATTGTTAAAGCTACTCGATTCTAA
>probe:Drosophila_2:1629181_at:661:537; Interrogation_Position=510; Antisense; GGTCAATACAAAATGCTCTTATCAA
>probe:Drosophila_2:1629181_at:608:393; Interrogation_Position=600; Antisense; GAAAGTGCCTTTTTGCCGTGTGTAT
>probe:Drosophila_2:1629181_at:481:567; Interrogation_Position=620; Antisense; TGTATTTTTTATATGTAAGGCCCCT
>probe:Drosophila_2:1629181_at:721:489; Interrogation_Position=633; Antisense; TGTAAGGCCCCTTTAAAGTCGGCAG
>probe:Drosophila_2:1629181_at:639:499; Interrogation_Position=650; Antisense; GTCGGCAGTCAACTGTTTGTTTACT
>probe:Drosophila_2:1629181_at:719:607; Interrogation_Position=674; Antisense; TGAGTCAGAATCTTGGAGTCGCCAT
>probe:Drosophila_2:1629181_at:609:431; Interrogation_Position=689; Antisense; GAGTCGCCATGATCAGTCGCATTGA

Paste this into a BLAST search page for me
AGAAACTCAGACAATCCTACGATTAACAATCCCCTCTATGGGTAACCAGTGTAACCAGTTCCAAAGTCCACTTAGAAGTCCACTTAGTCTTTGCTCTCGATAGTCTTTGCTCTCGAATCGGTCATGAATCGGTCATCCAAGCCTTTGAGAGATTGTTAAAGCTACTCGATTCTAAGGTCAATACAAAATGCTCTTATCAAGAAAGTGCCTTTTTGCCGTGTGTATTGTATTTTTTATATGTAAGGCCCCTTGTAAGGCCCCTTTAAAGTCGGCAGGTCGGCAGTCAACTGTTTGTTTACTTGAGTCAGAATCTTGGAGTCGCCATGAGTCGCCATGATCAGTCGCATTGA

Full Affymetrix probeset data:

Annotations for 1629181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720