FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629182_at:

>probe:Drosophila_2:1629182_at:65:601; Interrogation_Position=108; Antisense; TGTACGAGATCGCTGTGATTTCCCC
>probe:Drosophila_2:1629182_at:586:685; Interrogation_Position=181; Antisense; TATCATTTGCGCTATGTTCCCAGCA
>probe:Drosophila_2:1629182_at:346:89; Interrogation_Position=221; Antisense; AGTACTTCATCTGCGGCAACGGAAT
>probe:Drosophila_2:1629182_at:715:173; Interrogation_Position=25; Antisense; AAAGCTGTGTACATCCTGGTGACGC
>probe:Drosophila_2:1629182_at:567:581; Interrogation_Position=270; Antisense; TGGCCTCCACTTTAGTACCAAATGC
>probe:Drosophila_2:1629182_at:591:327; Interrogation_Position=293; Antisense; GCGATTGCTGCGATATTCCATCTAA
>probe:Drosophila_2:1629182_at:201:219; Interrogation_Position=316; Antisense; AAGTCGGACTGTCAGATCCCAGCAG
>probe:Drosophila_2:1629182_at:557:401; Interrogation_Position=368; Antisense; GACTTTCACCCGTTACTACTGTAGG
>probe:Drosophila_2:1629182_at:668:531; Interrogation_Position=410; Antisense; GGGTCCATTTCTATGTCCATGAGTC
>probe:Drosophila_2:1629182_at:526:497; Interrogation_Position=432; Antisense; GTCTCGACGAGATGCCTATTACTAT
>probe:Drosophila_2:1629182_at:175:65; Interrogation_Position=470; Antisense; ATGGTCTGGTTCTGGATTGTTCGGC
>probe:Drosophila_2:1629182_at:182:77; Interrogation_Position=521; Antisense; AGGAGTGTCGTGAACCCCAGAATGT
>probe:Drosophila_2:1629182_at:549:279; Interrogation_Position=65; Antisense; CTGCGAGGCTTTCAATTTCAGCACC
>probe:Drosophila_2:1629182_at:514:695; Interrogation_Position=80; Antisense; TTTCAGCACCTTCAGTTACCAGAGA

Paste this into a BLAST search page for me
TGTACGAGATCGCTGTGATTTCCCCTATCATTTGCGCTATGTTCCCAGCAAGTACTTCATCTGCGGCAACGGAATAAAGCTGTGTACATCCTGGTGACGCTGGCCTCCACTTTAGTACCAAATGCGCGATTGCTGCGATATTCCATCTAAAAGTCGGACTGTCAGATCCCAGCAGGACTTTCACCCGTTACTACTGTAGGGGGTCCATTTCTATGTCCATGAGTCGTCTCGACGAGATGCCTATTACTATATGGTCTGGTTCTGGATTGTTCGGCAGGAGTGTCGTGAACCCCAGAATGTCTGCGAGGCTTTCAATTTCAGCACCTTTCAGCACCTTCAGTTACCAGAGA

Full Affymetrix probeset data:

Annotations for 1629182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720