FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629184_at:

>probe:Drosophila_2:1629184_at:166:159; Interrogation_Position=1012; Antisense; ACAACGGCAACGGTCTGATTCCAGT
>probe:Drosophila_2:1629184_at:599:93; Interrogation_Position=1034; Antisense; AGTTCCCAAGCTATACTTCCGAGTG
>probe:Drosophila_2:1629184_at:68:493; Interrogation_Position=1059; Antisense; GTAATCGAACCATCCACCAAGAAGG
>probe:Drosophila_2:1629184_at:680:219; Interrogation_Position=1080; Antisense; AAGGGCATCGTTCTGATCGGCGTCA
>probe:Drosophila_2:1629184_at:444:493; Interrogation_Position=1101; Antisense; GTCAACAATCCCCATTTGAGTTTGG
>probe:Drosophila_2:1629184_at:545:121; Interrogation_Position=1135; Antisense; AGCGGGACTACATCCTGTGCACGGA
>probe:Drosophila_2:1629184_at:250:597; Interrogation_Position=1150; Antisense; TGTGCACGGACGTCAGCGACAGGAT
>probe:Drosophila_2:1629184_at:471:209; Interrogation_Position=1191; Antisense; AAGAAGACGGACATCACCGCCGGTT
>probe:Drosophila_2:1629184_at:336:211; Interrogation_Position=1248; Antisense; AAGAAGGTGACGCATCTGCCCGAGT
>probe:Drosophila_2:1629184_at:237:631; Interrogation_Position=1275; Antisense; TCCGTCAGCGGACTGTTGGTCTAAA
>probe:Drosophila_2:1629184_at:373:505; Interrogation_Position=778; Antisense; GTGCCAAGGCTGACTTCGTATTTGC
>probe:Drosophila_2:1629184_at:86:481; Interrogation_Position=795; Antisense; GTATTTGCCCCGGAGCAGAGGGCCA
>probe:Drosophila_2:1629184_at:508:653; Interrogation_Position=859; Antisense; TCAATGCTGGTAACTGGGCTCGCGT
>probe:Drosophila_2:1629184_at:227:99; Interrogation_Position=985; Antisense; AGAGGCAACTCTATTTGTCCCACGA

Paste this into a BLAST search page for me
ACAACGGCAACGGTCTGATTCCAGTAGTTCCCAAGCTATACTTCCGAGTGGTAATCGAACCATCCACCAAGAAGGAAGGGCATCGTTCTGATCGGCGTCAGTCAACAATCCCCATTTGAGTTTGGAGCGGGACTACATCCTGTGCACGGATGTGCACGGACGTCAGCGACAGGATAAGAAGACGGACATCACCGCCGGTTAAGAAGGTGACGCATCTGCCCGAGTTCCGTCAGCGGACTGTTGGTCTAAAGTGCCAAGGCTGACTTCGTATTTGCGTATTTGCCCCGGAGCAGAGGGCCATCAATGCTGGTAACTGGGCTCGCGTAGAGGCAACTCTATTTGTCCCACGA

Full Affymetrix probeset data:

Annotations for 1629184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720