Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629185_at:

>probe:Drosophila_2:1629185_at:64:103; Interrogation_Position=5866; Antisense; AGAGCGTTGGCCCATCTCTGGTCTA
>probe:Drosophila_2:1629185_at:407:641; Interrogation_Position=5882; Antisense; TCTGGTCTATGCAACCACTGGCAAC
>probe:Drosophila_2:1629185_at:49:143; Interrogation_Position=5898; Antisense; ACTGGCAACCGCGTGGGCGTCTATG
>probe:Drosophila_2:1629185_at:7:329; Interrogation_Position=5914; Antisense; GCGTCTATGCGGATGTGGCCCACTC
>probe:Drosophila_2:1629185_at:125:35; Interrogation_Position=5955; Antisense; ATCACCAAACTTCGCTCGGAGACAT
>probe:Drosophila_2:1629185_at:521:105; Interrogation_Position=5974; Antisense; AGACATTCCGCGGTGTGCTAACCTC
>probe:Drosophila_2:1629185_at:467:597; Interrogation_Position=5987; Antisense; TGTGCTAACCTCACTGGCCGTGTTG
>probe:Drosophila_2:1629185_at:188:581; Interrogation_Position=6001; Antisense; TGGCCGTGTTGCCACTGAATCGAGC
>probe:Drosophila_2:1629185_at:285:613; Interrogation_Position=6016; Antisense; TGAATCGAGCCTTCCTCGCGGGAAA
>probe:Drosophila_2:1629185_at:534:425; Interrogation_Position=6042; Antisense; GAGAGCGGAAACATAGCCCTGCTTT
>probe:Drosophila_2:1629185_at:637:301; Interrogation_Position=6058; Antisense; CCCTGCTTTGCTAGAATTTTTGGTA
>probe:Drosophila_2:1629185_at:261:435; Interrogation_Position=6225; Antisense; GAGGTAGCGCTTGCATTGCTATTAT
>probe:Drosophila_2:1629185_at:488:449; Interrogation_Position=6266; Antisense; GATCGCACATTTATAGCTACTTTCT
>probe:Drosophila_2:1629185_at:702:31; Interrogation_Position=6300; Antisense; ATCAAAGCATTCCAGGTCCACAATT

Paste this into a BLAST search page for me
AGAGCGTTGGCCCATCTCTGGTCTATCTGGTCTATGCAACCACTGGCAACACTGGCAACCGCGTGGGCGTCTATGGCGTCTATGCGGATGTGGCCCACTCATCACCAAACTTCGCTCGGAGACATAGACATTCCGCGGTGTGCTAACCTCTGTGCTAACCTCACTGGCCGTGTTGTGGCCGTGTTGCCACTGAATCGAGCTGAATCGAGCCTTCCTCGCGGGAAAGAGAGCGGAAACATAGCCCTGCTTTCCCTGCTTTGCTAGAATTTTTGGTAGAGGTAGCGCTTGCATTGCTATTATGATCGCACATTTATAGCTACTTTCTATCAAAGCATTCCAGGTCCACAATT

Full Affymetrix probeset data:

Annotations for 1629185_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime