Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629187_s_at:

>probe:Drosophila_2:1629187_s_at:95:189; Interrogation_Position=110; Antisense; AACAGAAGCTGAAATTGCAATTGCA
>probe:Drosophila_2:1629187_s_at:638:265; Interrogation_Position=145; Antisense; CAGTTGCAGATTGGTCAGGACGCGA
>probe:Drosophila_2:1629187_s_at:145:431; Interrogation_Position=197; Antisense; GAGTAGAGCTGTTGGGCTTACCCAA
>probe:Drosophila_2:1629187_s_at:135:223; Interrogation_Position=221; Antisense; AAGGTACCGAGAACAATTGCAAGAC
>probe:Drosophila_2:1629187_s_at:3:5; Interrogation_Position=236; Antisense; ATTGCAAGACGCCAAACTCAACCGC
>probe:Drosophila_2:1629187_s_at:265:193; Interrogation_Position=250; Antisense; AACTCAACCGCAAAAGTCGCCAACA
>probe:Drosophila_2:1629187_s_at:218:359; Interrogation_Position=259; Antisense; GCAAAAGTCGCCAACATAACACATA
>probe:Drosophila_2:1629187_s_at:269:661; Interrogation_Position=282; Antisense; TAAAATTTTCGGTTGGCTACGCAAG
>probe:Drosophila_2:1629187_s_at:549:715; Interrogation_Position=289; Antisense; TTCGGTTGGCTACGCAAGACACGCA
>probe:Drosophila_2:1629187_s_at:152:361; Interrogation_Position=302; Antisense; GCAAGACACGCAACAAACGACCAGT
>probe:Drosophila_2:1629187_s_at:211:177; Interrogation_Position=316; Antisense; AAACGACCAGTCGAGATCCTCAACA
>probe:Drosophila_2:1629187_s_at:420:97; Interrogation_Position=329; Antisense; AGATCCTCAACAGCGATTTCGGCGA
>probe:Drosophila_2:1629187_s_at:538:159; Interrogation_Position=39; Antisense; ACAAAAGCTGATCCAGCAGCTCCAG
>probe:Drosophila_2:1629187_s_at:527:113; Interrogation_Position=74; Antisense; AGCAGCAGGCGATCGCTTTCAGGGA

Paste this into a BLAST search page for me
AACAGAAGCTGAAATTGCAATTGCACAGTTGCAGATTGGTCAGGACGCGAGAGTAGAGCTGTTGGGCTTACCCAAAAGGTACCGAGAACAATTGCAAGACATTGCAAGACGCCAAACTCAACCGCAACTCAACCGCAAAAGTCGCCAACAGCAAAAGTCGCCAACATAACACATATAAAATTTTCGGTTGGCTACGCAAGTTCGGTTGGCTACGCAAGACACGCAGCAAGACACGCAACAAACGACCAGTAAACGACCAGTCGAGATCCTCAACAAGATCCTCAACAGCGATTTCGGCGAACAAAAGCTGATCCAGCAGCTCCAGAGCAGCAGGCGATCGCTTTCAGGGA

Full Affymetrix probeset data:

Annotations for 1629187_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime