FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629188_at:

>probe:Drosophila_2:1629188_at:708:671; Interrogation_Position=1024; Antisense; TACGCATGCCAGCTGTTACCGAGAA
>probe:Drosophila_2:1629188_at:216:423; Interrogation_Position=1044; Antisense; GAGAAGGATCTGACGCCTGCGCTAG
>probe:Drosophila_2:1629188_at:73:167; Interrogation_Position=1081; Antisense; AAAGGGCCAAGCTCGTGGTTCAAAT
>probe:Drosophila_2:1629188_at:702:49; Interrogation_Position=574; Antisense; ATGCCTGGCGCAATCTGTACACTAT
>probe:Drosophila_2:1629188_at:202:443; Interrogation_Position=600; Antisense; GATGTCAAGACCTTTACGCACTCTA
>probe:Drosophila_2:1629188_at:612:355; Interrogation_Position=617; Antisense; GCACTCTACGATGGCCGACATTGGA
>probe:Drosophila_2:1629188_at:164:403; Interrogation_Position=633; Antisense; GACATTGGACCAGCAGCACGGGAAT
>probe:Drosophila_2:1629188_at:238:663; Interrogation_Position=685; Antisense; TAAACCCTGCTTTGCCCAAGATTAG
>probe:Drosophila_2:1629188_at:420:511; Interrogation_Position=789; Antisense; GTGAACATCATTCGCTATCTGGGCC
>probe:Drosophila_2:1629188_at:312:429; Interrogation_Position=828; Antisense; GAGTATCGTTATGAGGGCTCTCCGC
>probe:Drosophila_2:1629188_at:504:229; Interrogation_Position=858; Antisense; AATGAGATCGACCTTGTCCTGGACA
>probe:Drosophila_2:1629188_at:199:587; Interrogation_Position=877; Antisense; TGGACATTTGCTACCAACTGCTGCG
>probe:Drosophila_2:1629188_at:378:113; Interrogation_Position=961; Antisense; AGCAGCAGTATTTCGGTGGATCCCA
>probe:Drosophila_2:1629188_at:315:443; Interrogation_Position=999; Antisense; GATGTCGGTGTCTACAGCTCACTGA

Paste this into a BLAST search page for me
TACGCATGCCAGCTGTTACCGAGAAGAGAAGGATCTGACGCCTGCGCTAGAAAGGGCCAAGCTCGTGGTTCAAATATGCCTGGCGCAATCTGTACACTATGATGTCAAGACCTTTACGCACTCTAGCACTCTACGATGGCCGACATTGGAGACATTGGACCAGCAGCACGGGAATTAAACCCTGCTTTGCCCAAGATTAGGTGAACATCATTCGCTATCTGGGCCGAGTATCGTTATGAGGGCTCTCCGCAATGAGATCGACCTTGTCCTGGACATGGACATTTGCTACCAACTGCTGCGAGCAGCAGTATTTCGGTGGATCCCAGATGTCGGTGTCTACAGCTCACTGA

Full Affymetrix probeset data:

Annotations for 1629188_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720