FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629195_at:

>probe:Drosophila_2:1629195_at:561:13; Interrogation_Position=1025; Antisense; ATTAATGTGAAGTTGCTGCCTGGGT
>probe:Drosophila_2:1629195_at:611:297; Interrogation_Position=604; Antisense; CGAATTCCTGCCACTGATCAATAAT
>probe:Drosophila_2:1629195_at:273:651; Interrogation_Position=690; Antisense; TAATGATCGGCGGACCCAACGACGA
>probe:Drosophila_2:1629195_at:387:409; Interrogation_Position=710; Antisense; GACGATGTGATTACTCCGTGGCAAT
>probe:Drosophila_2:1629195_at:363:413; Interrogation_Position=736; Antisense; GAGCCACTTTGGTTACTTTGACGAG
>probe:Drosophila_2:1629195_at:539:601; Interrogation_Position=771; Antisense; TGATTCCATTTATTAGGCGACCGAT
>probe:Drosophila_2:1629195_at:691:705; Interrogation_Position=783; Antisense; TTAGGCGACCGATTTTCACCAGCGA
>probe:Drosophila_2:1629195_at:359:129; Interrogation_Position=800; Antisense; ACCAGCGACTCCATTGGCATCAGGA
>probe:Drosophila_2:1629195_at:662:645; Interrogation_Position=819; Antisense; TCAGGACGCTTCAGGAGGCCGGCAA
>probe:Drosophila_2:1629195_at:141:579; Interrogation_Position=835; Antisense; GGCCGGCAAGCTTATCATTGTGGTC
>probe:Drosophila_2:1629195_at:149:5; Interrogation_Position=851; Antisense; ATTGTGGTCAAACCCCATGTTCATC
>probe:Drosophila_2:1629195_at:39:61; Interrogation_Position=867; Antisense; ATGTTCATCATCTTGCCTGGCACAC
>probe:Drosophila_2:1629195_at:564:565; Interrogation_Position=885; Antisense; GGCACACGCGAAGGGATGTCATCCA
>probe:Drosophila_2:1629195_at:612:169; Interrogation_Position=991; Antisense; AAAGGCGGACAAAGGCTCACTCTCA

Paste this into a BLAST search page for me
ATTAATGTGAAGTTGCTGCCTGGGTCGAATTCCTGCCACTGATCAATAATTAATGATCGGCGGACCCAACGACGAGACGATGTGATTACTCCGTGGCAATGAGCCACTTTGGTTACTTTGACGAGTGATTCCATTTATTAGGCGACCGATTTAGGCGACCGATTTTCACCAGCGAACCAGCGACTCCATTGGCATCAGGATCAGGACGCTTCAGGAGGCCGGCAAGGCCGGCAAGCTTATCATTGTGGTCATTGTGGTCAAACCCCATGTTCATCATGTTCATCATCTTGCCTGGCACACGGCACACGCGAAGGGATGTCATCCAAAAGGCGGACAAAGGCTCACTCTCA

Full Affymetrix probeset data:

Annotations for 1629195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720