FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629197_at:

>probe:Drosophila_2:1629197_at:251:201; Interrogation_Position=1038; Antisense; AACCAAGAATGTAAGCCCCGACTCG
>probe:Drosophila_2:1629197_at:440:365; Interrogation_Position=552; Antisense; GAATCTTAAGATCAACCTCACCGTC
>probe:Drosophila_2:1629197_at:304:557; Interrogation_Position=588; Antisense; GGACAGACCCGTAATCTATGGCCAA
>probe:Drosophila_2:1629197_at:576:713; Interrogation_Position=646; Antisense; TTCAGTGAGGGCAACGACATCGTCC
>probe:Drosophila_2:1629197_at:548:39; Interrogation_Position=664; Antisense; ATCGTCCTGTCCTGCGAAGTTTCAG
>probe:Drosophila_2:1629197_at:233:323; Interrogation_Position=699; Antisense; GCGACCTAATGTCACCTGGTACTTG
>probe:Drosophila_2:1629197_at:634:157; Interrogation_Position=728; Antisense; ACACGGCGATTGACGAGTCCTTCGA
>probe:Drosophila_2:1629197_at:469:707; Interrogation_Position=776; Antisense; TTAACCACCTGTCGTACCCAAATGT
>probe:Drosophila_2:1629197_at:27:231; Interrogation_Position=796; Antisense; AATGTGGGCAGGCAGCACCTCAATT
>probe:Drosophila_2:1629197_at:223:653; Interrogation_Position=815; Antisense; TCAATTCCCGGCTAATGTGCGTGGC
>probe:Drosophila_2:1629197_at:482:237; Interrogation_Position=868; Antisense; AATCGGGTGGTCATCCTGGACGTGA
>probe:Drosophila_2:1629197_at:512:463; Interrogation_Position=903; Antisense; GATTGCCGTGCATATACTTACCAAG
>probe:Drosophila_2:1629197_at:78:451; Interrogation_Position=928; Antisense; GATCGATTCGTGTCTGCAGATCGCA
>probe:Drosophila_2:1629197_at:106:351; Interrogation_Position=943; Antisense; GCAGATCGCACCTATGACGTGGAGT

Paste this into a BLAST search page for me
AACCAAGAATGTAAGCCCCGACTCGGAATCTTAAGATCAACCTCACCGTCGGACAGACCCGTAATCTATGGCCAATTCAGTGAGGGCAACGACATCGTCCATCGTCCTGTCCTGCGAAGTTTCAGGCGACCTAATGTCACCTGGTACTTGACACGGCGATTGACGAGTCCTTCGATTAACCACCTGTCGTACCCAAATGTAATGTGGGCAGGCAGCACCTCAATTTCAATTCCCGGCTAATGTGCGTGGCAATCGGGTGGTCATCCTGGACGTGAGATTGCCGTGCATATACTTACCAAGGATCGATTCGTGTCTGCAGATCGCAGCAGATCGCACCTATGACGTGGAGT

Full Affymetrix probeset data:

Annotations for 1629197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720