Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629198_at:

>probe:Drosophila_2:1629198_at:232:371; Interrogation_Position=2868; Antisense; GAAGGCGGACATGCGGATCAAGATC
>probe:Drosophila_2:1629198_at:409:215; Interrogation_Position=2887; Antisense; AAGATCAAGTATCCGGACCAGCACA
>probe:Drosophila_2:1629198_at:177:55; Interrogation_Position=2911; Antisense; ATGCACACCGTGGTGCCGAAGCAGA
>probe:Drosophila_2:1629198_at:186:433; Interrogation_Position=2934; Antisense; GAGTGACTTCAAGCCCATTATGACG
>probe:Drosophila_2:1629198_at:389:553; Interrogation_Position=2958; Antisense; GGAGCAGGGCGAGCACAAGACCAAT
>probe:Drosophila_2:1629198_at:414:599; Interrogation_Position=3008; Antisense; TGTCGCACAGCGTTTGGACGGAGTC
>probe:Drosophila_2:1629198_at:193:431; Interrogation_Position=3028; Antisense; GAGTCGTCGCTGGTGGAGATCCAAC
>probe:Drosophila_2:1629198_at:19:589; Interrogation_Position=3041; Antisense; TGGAGATCCAACTGTGCCTGGCCGT
>probe:Drosophila_2:1629198_at:540:203; Interrogation_Position=3094; Antisense; AAGCCGGCAAAGGTGCTGTTCGCAC
>probe:Drosophila_2:1629198_at:684:523; Interrogation_Position=3135; Antisense; GGGCATTTAGCCTGACTTCCAGGTA
>probe:Drosophila_2:1629198_at:678:147; Interrogation_Position=3164; Antisense; ACTAGGTGCTTTTTGTCCTGGCGAC
>probe:Drosophila_2:1629198_at:334:417; Interrogation_Position=3192; Antisense; GAGCGAGAAGCTGACAAGGCCACAC
>probe:Drosophila_2:1629198_at:149:249; Interrogation_Position=3264; Antisense; AATTGGCGCAACGAGCAACTGTTAT
>probe:Drosophila_2:1629198_at:693:115; Interrogation_Position=3373; Antisense; AGCATCAGTTGTGCGTAGCTTACTT

Paste this into a BLAST search page for me
GAAGGCGGACATGCGGATCAAGATCAAGATCAAGTATCCGGACCAGCACAATGCACACCGTGGTGCCGAAGCAGAGAGTGACTTCAAGCCCATTATGACGGGAGCAGGGCGAGCACAAGACCAATTGTCGCACAGCGTTTGGACGGAGTCGAGTCGTCGCTGGTGGAGATCCAACTGGAGATCCAACTGTGCCTGGCCGTAAGCCGGCAAAGGTGCTGTTCGCACGGGCATTTAGCCTGACTTCCAGGTAACTAGGTGCTTTTTGTCCTGGCGACGAGCGAGAAGCTGACAAGGCCACACAATTGGCGCAACGAGCAACTGTTATAGCATCAGTTGTGCGTAGCTTACTT

Full Affymetrix probeset data:

Annotations for 1629198_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime