FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629199_at:

>probe:Drosophila_2:1629199_at:190:721; Interrogation_Position=266; Antisense; TTGCCGGTGGCTACGATTCCAATCA
>probe:Drosophila_2:1629199_at:321:615; Interrogation_Position=353; Antisense; TGAATGTGCGCCAGTGCAACATGGT
>probe:Drosophila_2:1629199_at:89:153; Interrogation_Position=371; Antisense; ACATGGTGCACGATAGCTGCCACAA
>probe:Drosophila_2:1629199_at:117:111; Interrogation_Position=422; Antisense; AGAATCTGGCATGGCAGGCCTACTC
>probe:Drosophila_2:1629199_at:282:401; Interrogation_Position=460; Antisense; GACATGGGCTACATCCTGGACAACA
>probe:Drosophila_2:1629199_at:367:357; Interrogation_Position=510; Antisense; GCACAACTCCAACGCCGGTATTATT
>probe:Drosophila_2:1629199_at:372:3; Interrogation_Position=571; Antisense; ATTGGCCACTTCACCGTGATGATGT
>probe:Drosophila_2:1629199_at:376:73; Interrogation_Position=601; Antisense; AGGAACACCCGCTTGGGATGTGCTG
>probe:Drosophila_2:1629199_at:237:443; Interrogation_Position=617; Antisense; GATGTGCTGCTGCTCGGTACAATCG
>probe:Drosophila_2:1629199_at:147:563; Interrogation_Position=650; Antisense; GGAACCAAGTGCTGGTGGCCTGCAA
>probe:Drosophila_2:1629199_at:300:673; Interrogation_Position=681; Antisense; TACCACCAATATGATCGGACGCCAG
>probe:Drosophila_2:1629199_at:74:155; Interrogation_Position=732; Antisense; ACAGGGCTGCGGATCGGGCACCAAT
>probe:Drosophila_2:1629199_at:52:431; Interrogation_Position=760; Antisense; GAGTTTGGTAACCTCTGCTCAACAT
>probe:Drosophila_2:1629199_at:40:185; Interrogation_Position=780; Antisense; AACATCCGAGTGGTACGACGTGAAC

Paste this into a BLAST search page for me
TTGCCGGTGGCTACGATTCCAATCATGAATGTGCGCCAGTGCAACATGGTACATGGTGCACGATAGCTGCCACAAAGAATCTGGCATGGCAGGCCTACTCGACATGGGCTACATCCTGGACAACAGCACAACTCCAACGCCGGTATTATTATTGGCCACTTCACCGTGATGATGTAGGAACACCCGCTTGGGATGTGCTGGATGTGCTGCTGCTCGGTACAATCGGGAACCAAGTGCTGGTGGCCTGCAATACCACCAATATGATCGGACGCCAGACAGGGCTGCGGATCGGGCACCAATGAGTTTGGTAACCTCTGCTCAACATAACATCCGAGTGGTACGACGTGAAC

Full Affymetrix probeset data:

Annotations for 1629199_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720