Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629201_at:

>probe:Drosophila_2:1629201_at:193:655; Interrogation_Position=359; Antisense; TAATCTGAACAAGATCTCGTCCCTG
>probe:Drosophila_2:1629201_at:267:423; Interrogation_Position=426; Antisense; GAGAAGCGGTATGCCCACTACAGTG
>probe:Drosophila_2:1629201_at:439:259; Interrogation_Position=441; Antisense; CACTACAGTGTGTTTCACGTGGGCA
>probe:Drosophila_2:1629201_at:243:59; Interrogation_Position=474; Antisense; AGTAATTACCCGATAACCCAGCTGG
>probe:Drosophila_2:1629201_at:347:377; Interrogation_Position=511; Antisense; GAACCGCCGGAGACAGTTTGAGCTA
>probe:Drosophila_2:1629201_at:440:609; Interrogation_Position=529; Antisense; TGAGCTATCATCTGTACCAACCTTT
>probe:Drosophila_2:1629201_at:163:203; Interrogation_Position=547; Antisense; AACCTTTCAGCACCTTCGATAGGGA
>probe:Drosophila_2:1629201_at:124:235; Interrogation_Position=579; Antisense; AATGCCACTATCAACTGTGCTGCCA
>probe:Drosophila_2:1629201_at:17:287; Interrogation_Position=617; Antisense; CTGGTGGTACAGAGAATGCCTTAGC
>probe:Drosophila_2:1629201_at:109:369; Interrogation_Position=650; Antisense; GAATGGTGCATATCTGGGTGGAAAC
>probe:Drosophila_2:1629201_at:245:321; Interrogation_Position=687; Antisense; GCGCTGTTTGGCTCTGGAATCGTTT
>probe:Drosophila_2:1629201_at:560:563; Interrogation_Position=721; Antisense; GGAAGGGCTTCACATACAGCTACAA
>probe:Drosophila_2:1629201_at:11:407; Interrogation_Position=746; Antisense; GACTGTTAACATTATGGTGCGACCA
>probe:Drosophila_2:1629201_at:233:455; Interrogation_Position=814; Antisense; GATAACTGCCTAAAACTATGAGCTG

Paste this into a BLAST search page for me
TAATCTGAACAAGATCTCGTCCCTGGAGAAGCGGTATGCCCACTACAGTGCACTACAGTGTGTTTCACGTGGGCAAGTAATTACCCGATAACCCAGCTGGGAACCGCCGGAGACAGTTTGAGCTATGAGCTATCATCTGTACCAACCTTTAACCTTTCAGCACCTTCGATAGGGAAATGCCACTATCAACTGTGCTGCCACTGGTGGTACAGAGAATGCCTTAGCGAATGGTGCATATCTGGGTGGAAACGCGCTGTTTGGCTCTGGAATCGTTTGGAAGGGCTTCACATACAGCTACAAGACTGTTAACATTATGGTGCGACCAGATAACTGCCTAAAACTATGAGCTG

Full Affymetrix probeset data:

Annotations for 1629201_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime