Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629202_at:

>probe:Drosophila_2:1629202_at:520:485; Interrogation_Position=2521; Antisense; GTAGTCAAAATTTCGAGGACATCCG
>probe:Drosophila_2:1629202_at:63:205; Interrogation_Position=2599; Antisense; AAGGCTCAGCCAAAAACTGTGGTCA
>probe:Drosophila_2:1629202_at:658:213; Interrogation_Position=2633; Antisense; AAGAGTTGGCAAAGTCCTGCGATAT
>probe:Drosophila_2:1629202_at:349:219; Interrogation_Position=2644; Antisense; AAGTCCTGCGATATTGTACTCGAAA
>probe:Drosophila_2:1629202_at:722:483; Interrogation_Position=2659; Antisense; GTACTCGAAAACTGCAAGACCGTAA
>probe:Drosophila_2:1629202_at:432:373; Interrogation_Position=2763; Antisense; GAAGTGCAAAACGATCAAGCTCGAA
>probe:Drosophila_2:1629202_at:283:227; Interrogation_Position=2836; Antisense; AAGGCATACACTTTCAGTACTAGAG
>probe:Drosophila_2:1629202_at:215:653; Interrogation_Position=2876; Antisense; TAATTCCACCAAAGCGTTATCGCGT
>probe:Drosophila_2:1629202_at:602:205; Interrogation_Position=2887; Antisense; AAGCGTTATCGCGTTGTACGCGGCT
>probe:Drosophila_2:1629202_at:305:487; Interrogation_Position=2902; Antisense; GTACGCGGCTCTGCAATTGTTAAAC
>probe:Drosophila_2:1629202_at:494:239; Interrogation_Position=2938; Antisense; AATAAAGCCAGCGAGAGTCCAACAG
>probe:Drosophila_2:1629202_at:34:123; Interrogation_Position=2947; Antisense; AGCGAGAGTCCAACAGCTGCGAGCA
>probe:Drosophila_2:1629202_at:645:419; Interrogation_Position=2967; Antisense; GAGCAGATTGTCGAGTTTCGCTGAA
>probe:Drosophila_2:1629202_at:293:667; Interrogation_Position=3020; Antisense; TACATTTACGGAGAGCGAATCGCTG

Paste this into a BLAST search page for me
GTAGTCAAAATTTCGAGGACATCCGAAGGCTCAGCCAAAAACTGTGGTCAAAGAGTTGGCAAAGTCCTGCGATATAAGTCCTGCGATATTGTACTCGAAAGTACTCGAAAACTGCAAGACCGTAAGAAGTGCAAAACGATCAAGCTCGAAAAGGCATACACTTTCAGTACTAGAGTAATTCCACCAAAGCGTTATCGCGTAAGCGTTATCGCGTTGTACGCGGCTGTACGCGGCTCTGCAATTGTTAAACAATAAAGCCAGCGAGAGTCCAACAGAGCGAGAGTCCAACAGCTGCGAGCAGAGCAGATTGTCGAGTTTCGCTGAATACATTTACGGAGAGCGAATCGCTG

Full Affymetrix probeset data:

Annotations for 1629202_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime