FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629205_at:

>probe:Drosophila_2:1629205_at:179:647; Interrogation_Position=353; Antisense; TCATTCATCTGACCGATGCCACGGA
>probe:Drosophila_2:1629205_at:128:455; Interrogation_Position=376; Antisense; GATCAGATCCGTTTGAGCCAAGCAA
>probe:Drosophila_2:1629205_at:266:445; Interrogation_Position=493; Antisense; GATGAGTACCCGTTGAGATCGATTC
>probe:Drosophila_2:1629205_at:151:83; Interrogation_Position=520; Antisense; AGCCAGCAGAAGTACCTACGTTTGA
>probe:Drosophila_2:1629205_at:476:85; Interrogation_Position=595; Antisense; AGTGCACCTGGTCAGTGGTCCAACA
>probe:Drosophila_2:1629205_at:358:649; Interrogation_Position=606; Antisense; TCAGTGGTCCAACATCGGCGATCAG
>probe:Drosophila_2:1629205_at:490:649; Interrogation_Position=668; Antisense; TCACGGGCACTGTCCAGGTGGTGAA
>probe:Drosophila_2:1629205_at:92:175; Interrogation_Position=691; Antisense; AAAGCGGTCAACGATCACCTGGTGC
>probe:Drosophila_2:1629205_at:565:413; Interrogation_Position=717; Antisense; GACCTTCTGCGGCAACGATGTTAAG
>probe:Drosophila_2:1629205_at:188:23; Interrogation_Position=748; Antisense; ATATACACAGTGGTTCTCACCCGCA
>probe:Drosophila_2:1629205_at:153:249; Interrogation_Position=771; Antisense; CAATCGCCTTGGTCTCAGTTTAGAT
>probe:Drosophila_2:1629205_at:219:487; Interrogation_Position=803; Antisense; GTAGCATCAGGAATCTGCTTTCCCG
>probe:Drosophila_2:1629205_at:477:519; Interrogation_Position=830; Antisense; GTGGACTCTACACGGAGACCATTCG
>probe:Drosophila_2:1629205_at:502:703; Interrogation_Position=904; Antisense; TTAGCCCTTTTGCTGGTCGTACGTT

Paste this into a BLAST search page for me
TCATTCATCTGACCGATGCCACGGAGATCAGATCCGTTTGAGCCAAGCAAGATGAGTACCCGTTGAGATCGATTCAGCCAGCAGAAGTACCTACGTTTGAAGTGCACCTGGTCAGTGGTCCAACATCAGTGGTCCAACATCGGCGATCAGTCACGGGCACTGTCCAGGTGGTGAAAAAGCGGTCAACGATCACCTGGTGCGACCTTCTGCGGCAACGATGTTAAGATATACACAGTGGTTCTCACCCGCACAATCGCCTTGGTCTCAGTTTAGATGTAGCATCAGGAATCTGCTTTCCCGGTGGACTCTACACGGAGACCATTCGTTAGCCCTTTTGCTGGTCGTACGTT

Full Affymetrix probeset data:

Annotations for 1629205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720