FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629207_at:

>probe:Drosophila_2:1629207_at:120:553; Interrogation_Position=1036; Antisense; GGAGCAGTTCATCGCCCTCAATGGA
>probe:Drosophila_2:1629207_at:616:583; Interrogation_Position=1057; Antisense; TGGAACCTCGCCGAAGTACACCAGT
>probe:Drosophila_2:1629207_at:585:89; Interrogation_Position=1071; Antisense; AGTACACCAGTTATGCGGGCGTTAT
>probe:Drosophila_2:1629207_at:711:633; Interrogation_Position=1095; Antisense; TTAACAAGGAGGCACTCGCCCATTA
>probe:Drosophila_2:1629207_at:659:281; Interrogation_Position=1109; Antisense; CTCGCCCATTACCAGTGAAGCAAAT
>probe:Drosophila_2:1629207_at:39:691; Interrogation_Position=1138; Antisense; TATTCACAACCATCAGCACATTCTA
>probe:Drosophila_2:1629207_at:482:85; Interrogation_Position=711; Antisense; AGATTTGGCCACTGGCGGACTACAT
>probe:Drosophila_2:1629207_at:558:45; Interrogation_Position=755; Antisense; ATCCCAGCCACCAGAAATCTCATAT
>probe:Drosophila_2:1629207_at:605:23; Interrogation_Position=776; Antisense; ATATCGGCGGAGACACTGGCCAAGT
>probe:Drosophila_2:1629207_at:118:347; Interrogation_Position=840; Antisense; GCATCATCGACGAGCAGGCCGTGCT
>probe:Drosophila_2:1629207_at:40:621; Interrogation_Position=861; Antisense; TGCTCGATGGCCTTGAGAGCGGAAA
>probe:Drosophila_2:1629207_at:297:577; Interrogation_Position=898; Antisense; GGCCTTCGACGTTTATCCCGAGGAG
>probe:Drosophila_2:1629207_at:302:437; Interrogation_Position=917; Antisense; GAGGAGCCGCCAAAGTCTGCGGTCA
>probe:Drosophila_2:1629207_at:574:297; Interrogation_Position=949; Antisense; CCTCATCAGTCATCCCAAGGTGGTG

Paste this into a BLAST search page for me
GGAGCAGTTCATCGCCCTCAATGGATGGAACCTCGCCGAAGTACACCAGTAGTACACCAGTTATGCGGGCGTTATTTAACAAGGAGGCACTCGCCCATTACTCGCCCATTACCAGTGAAGCAAATTATTCACAACCATCAGCACATTCTAAGATTTGGCCACTGGCGGACTACATATCCCAGCCACCAGAAATCTCATATATATCGGCGGAGACACTGGCCAAGTGCATCATCGACGAGCAGGCCGTGCTTGCTCGATGGCCTTGAGAGCGGAAAGGCCTTCGACGTTTATCCCGAGGAGGAGGAGCCGCCAAAGTCTGCGGTCACCTCATCAGTCATCCCAAGGTGGTG

Full Affymetrix probeset data:

Annotations for 1629207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720