FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629208_at:

>probe:Drosophila_2:1629208_at:474:589; Interrogation_Position=107; Antisense; TGGGAATTACCCCAGATTACTTCGA
>probe:Drosophila_2:1629208_at:14:463; Interrogation_Position=121; Antisense; GATTACTTCGAAAATTTTCCGCACA
>probe:Drosophila_2:1629208_at:354:693; Interrogation_Position=136; Antisense; TTTCCGCACAGCAGTCGGGTGAAGT
>probe:Drosophila_2:1629208_at:137:535; Interrogation_Position=153; Antisense; GGTGAAGTGCTTTTACCACTGCCAA
>probe:Drosophila_2:1629208_at:174:171; Interrogation_Position=16; Antisense; AAAGTATTCATTGGCCTGGTTCTGT
>probe:Drosophila_2:1629208_at:504:33; Interrogation_Position=193; Antisense; ATAATTGCCAATGGTGTGGTAACAC
>probe:Drosophila_2:1629208_at:447:519; Interrogation_Position=208; Antisense; GTGGTAACACCATTCGATTTGAAAG
>probe:Drosophila_2:1629208_at:698:489; Interrogation_Position=277; Antisense; GTAAAACCATGCCTCAAACTATCGC
>probe:Drosophila_2:1629208_at:657:683; Interrogation_Position=296; Antisense; TATCGCATCGCGACAAATGTGAGCT
>probe:Drosophila_2:1629208_at:435:287; Interrogation_Position=31; Antisense; CTGGTTCTGTTGTTAGCTGTCACTA
>probe:Drosophila_2:1629208_at:515:61; Interrogation_Position=312; Antisense; ATGTGAGCTCGGTTACTTGGTGTTC
>probe:Drosophila_2:1629208_at:374:275; Interrogation_Position=327; Antisense; CTTGGTGTTCCAGTGCTTGAAACGA
>probe:Drosophila_2:1629208_at:665:725; Interrogation_Position=40; Antisense; TTGTTAGCTGTCACTACGCTGTCAT
>probe:Drosophila_2:1629208_at:285:285; Interrogation_Position=58; Antisense; CTGTCATCCGCTTTATTCGAATCTG

Paste this into a BLAST search page for me
TGGGAATTACCCCAGATTACTTCGAGATTACTTCGAAAATTTTCCGCACATTTCCGCACAGCAGTCGGGTGAAGTGGTGAAGTGCTTTTACCACTGCCAAAAAGTATTCATTGGCCTGGTTCTGTATAATTGCCAATGGTGTGGTAACACGTGGTAACACCATTCGATTTGAAAGGTAAAACCATGCCTCAAACTATCGCTATCGCATCGCGACAAATGTGAGCTCTGGTTCTGTTGTTAGCTGTCACTAATGTGAGCTCGGTTACTTGGTGTTCCTTGGTGTTCCAGTGCTTGAAACGATTGTTAGCTGTCACTACGCTGTCATCTGTCATCCGCTTTATTCGAATCTG

Full Affymetrix probeset data:

Annotations for 1629208_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720