FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629209_at:

>probe:Drosophila_2:1629209_at:307:441; Interrogation_Position=408; Antisense; GATGGCACCATCTTTGGAATCACCT
>probe:Drosophila_2:1629209_at:4:565; Interrogation_Position=423; Antisense; GGAATCACCTCTGTGCTGAACCTGA
>probe:Drosophila_2:1629209_at:451:225; Interrogation_Position=482; Antisense; AAGGACCTACATACTGGATCGCGCC
>probe:Drosophila_2:1629209_at:654:715; Interrogation_Position=518; Antisense; TTCTCCGGAGGTTCAGCAGCAGTTG
>probe:Drosophila_2:1629209_at:614:123; Interrogation_Position=565; Antisense; AGCGCCATGTGGGATTCTTGATCAA
>probe:Drosophila_2:1629209_at:467:199; Interrogation_Position=588; Antisense; AACGAGCGCTTTATCAATATCCCTG
>probe:Drosophila_2:1629209_at:446:395; Interrogation_Position=680; Antisense; GAAATACGACTTTGGCACTCTGCTG
>probe:Drosophila_2:1629209_at:10:643; Interrogation_Position=698; Antisense; TCTGCTGCTGCTGGTTAAGTTCTAC
>probe:Drosophila_2:1629209_at:251:557; Interrogation_Position=755; Antisense; GGACGTGTACACCAACGCTGAGGAT
>probe:Drosophila_2:1629209_at:588:57; Interrogation_Position=778; Antisense; ATGAGTTGCTTTCGGATCGGGCTAA
>probe:Drosophila_2:1629209_at:399:217; Interrogation_Position=801; Antisense; AAGTTCTCCTTCGAGTATTCCATGG
>probe:Drosophila_2:1629209_at:92:689; Interrogation_Position=816; Antisense; TATTCCATGGCCTCTGAAACCGATT
>probe:Drosophila_2:1629209_at:298:391; Interrogation_Position=893; Antisense; GAAACTCCTGGTCCTGGAGGCCAAA
>probe:Drosophila_2:1629209_at:444:439; Interrogation_Position=909; Antisense; GAGGCCAAAAAACTTCCGCAGCTTA

Paste this into a BLAST search page for me
GATGGCACCATCTTTGGAATCACCTGGAATCACCTCTGTGCTGAACCTGAAAGGACCTACATACTGGATCGCGCCTTCTCCGGAGGTTCAGCAGCAGTTGAGCGCCATGTGGGATTCTTGATCAAAACGAGCGCTTTATCAATATCCCTGGAAATACGACTTTGGCACTCTGCTGTCTGCTGCTGCTGGTTAAGTTCTACGGACGTGTACACCAACGCTGAGGATATGAGTTGCTTTCGGATCGGGCTAAAAGTTCTCCTTCGAGTATTCCATGGTATTCCATGGCCTCTGAAACCGATTGAAACTCCTGGTCCTGGAGGCCAAAGAGGCCAAAAAACTTCCGCAGCTTA

Full Affymetrix probeset data:

Annotations for 1629209_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720