FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629212_at:

>probe:Drosophila_2:1629212_at:561:551; Interrogation_Position=1012; Antisense; GGAGCTGAGTGCCTTCTTGACTACA
>probe:Drosophila_2:1629212_at:36:667; Interrogation_Position=1033; Antisense; TACACTGGCGTACGGCAGACGACAA
>probe:Drosophila_2:1629212_at:389:161; Interrogation_Position=1054; Antisense; ACAAGGATTTTCAACTGTCGGCGAA
>probe:Drosophila_2:1629212_at:15:563; Interrogation_Position=546; Antisense; GGAAGAGCACTGTGTTTCCGCCGAC
>probe:Drosophila_2:1629212_at:392:319; Interrogation_Position=565; Antisense; GCCGACGCTTACGAGATCCGAAGGA
>probe:Drosophila_2:1629212_at:365:29; Interrogation_Position=610; Antisense; ATACTGCTTCGCTTTTCCGTTAAGG
>probe:Drosophila_2:1629212_at:99:711; Interrogation_Position=629; Antisense; TTAAGGCTTCCAATGTGGGCACCGC
>probe:Drosophila_2:1629212_at:492:441; Interrogation_Position=655; Antisense; GATGTAAGCCCATACGCTAACTACA
>probe:Drosophila_2:1629212_at:53:371; Interrogation_Position=723; Antisense; GAATGTTTTTGCCACCTTTGATGTT
>probe:Drosophila_2:1629212_at:221:605; Interrogation_Position=741; Antisense; TGATGTTTACGACCTCAACTACCGG
>probe:Drosophila_2:1629212_at:264:227; Interrogation_Position=784; Antisense; AAGGCCTCCTTTTGCCTGATGGACA
>probe:Drosophila_2:1629212_at:291:225; Interrogation_Position=860; Antisense; AAGGCATTTCCGTGGGCTGCGCAGA
>probe:Drosophila_2:1629212_at:52:667; Interrogation_Position=889; Antisense; TACACCGATGTGTTGGACTGCCAGT
>probe:Drosophila_2:1629212_at:362:589; Interrogation_Position=917; Antisense; TGGATGTTACCCGAGTTCCCATCAA

Paste this into a BLAST search page for me
GGAGCTGAGTGCCTTCTTGACTACATACACTGGCGTACGGCAGACGACAAACAAGGATTTTCAACTGTCGGCGAAGGAAGAGCACTGTGTTTCCGCCGACGCCGACGCTTACGAGATCCGAAGGAATACTGCTTCGCTTTTCCGTTAAGGTTAAGGCTTCCAATGTGGGCACCGCGATGTAAGCCCATACGCTAACTACAGAATGTTTTTGCCACCTTTGATGTTTGATGTTTACGACCTCAACTACCGGAAGGCCTCCTTTTGCCTGATGGACAAAGGCATTTCCGTGGGCTGCGCAGATACACCGATGTGTTGGACTGCCAGTTGGATGTTACCCGAGTTCCCATCAA

Full Affymetrix probeset data:

Annotations for 1629212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720