Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629215_at:

>probe:Drosophila_2:1629215_at:3:15; Interrogation_Position=382; Antisense; ATTATAACGGCCGACTTTGCTTCCG
>probe:Drosophila_2:1629215_at:360:585; Interrogation_Position=459; Antisense; TGGAAAGAACTTCCTGCGACCCTTT
>probe:Drosophila_2:1629215_at:217:201; Interrogation_Position=513; Antisense; AACGCGACACGATTTCATTGAGACA
>probe:Drosophila_2:1629215_at:168:729; Interrogation_Position=557; Antisense; TTGGCATACCAATTCTCGGCTACTT
>probe:Drosophila_2:1629215_at:714:537; Interrogation_Position=574; Antisense; GGCTACTTGGCCCACTATTTTTACA
>probe:Drosophila_2:1629215_at:24:689; Interrogation_Position=589; Antisense; TATTTTTACATCAGGACGCCCAGCG
>probe:Drosophila_2:1629215_at:638:573; Interrogation_Position=631; Antisense; GGCTGGATAGCCTATGTGTTCCTCT
>probe:Drosophila_2:1629215_at:439:19; Interrogation_Position=661; Antisense; ATATTCGTGGCCATGACCAATCAGA
>probe:Drosophila_2:1629215_at:270:603; Interrogation_Position=731; Antisense; TGTTACTCCAGAGCTGTCACATCAT
>probe:Drosophila_2:1629215_at:226:153; Interrogation_Position=795; Antisense; ACATGAGACCTACTTTTGCATCACC
>probe:Drosophila_2:1629215_at:226:197; Interrogation_Position=832; Antisense; AACTGGCCACTGGAACGCATCAGAT
>probe:Drosophila_2:1629215_at:555:461; Interrogation_Position=854; Antisense; GATTCTGGTCAACATTCGAGCTCAT
>probe:Drosophila_2:1629215_at:634:41; Interrogation_Position=880; Antisense; ATCGAGCATTTTACGGGCCTCAAGC
>probe:Drosophila_2:1629215_at:47:325; Interrogation_Position=908; Antisense; GCGATGACGACCTGAAGTGGGCCAA

Paste this into a BLAST search page for me
ATTATAACGGCCGACTTTGCTTCCGTGGAAAGAACTTCCTGCGACCCTTTAACGCGACACGATTTCATTGAGACATTGGCATACCAATTCTCGGCTACTTGGCTACTTGGCCCACTATTTTTACATATTTTTACATCAGGACGCCCAGCGGGCTGGATAGCCTATGTGTTCCTCTATATTCGTGGCCATGACCAATCAGATGTTACTCCAGAGCTGTCACATCATACATGAGACCTACTTTTGCATCACCAACTGGCCACTGGAACGCATCAGATGATTCTGGTCAACATTCGAGCTCATATCGAGCATTTTACGGGCCTCAAGCGCGATGACGACCTGAAGTGGGCCAA

Full Affymetrix probeset data:

Annotations for 1629215_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime