Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629216_at:

>probe:Drosophila_2:1629216_at:700:179; Interrogation_Position=2800; Antisense; AAAAAACATCCCCAAGCAGCTTCGT
>probe:Drosophila_2:1629216_at:550:209; Interrogation_Position=2813; Antisense; AAGCAGCTTCGTCCTGTGAATGCGC
>probe:Drosophila_2:1629216_at:190:287; Interrogation_Position=2826; Antisense; CTGTGAATGCGCTTTGTGCTTTAAA
>probe:Drosophila_2:1629216_at:581:203; Interrogation_Position=2849; Antisense; AAGCCTTCCGAAAAAGCTCAAGTGC
>probe:Drosophila_2:1629216_at:416:239; Interrogation_Position=2910; Antisense; AATCAGCAGTTCAGTGGTCTCCGGA
>probe:Drosophila_2:1629216_at:583:463; Interrogation_Position=2933; Antisense; GATTCGTGTTGGTGGTGAGCCATAC
>probe:Drosophila_2:1629216_at:255:511; Interrogation_Position=2947; Antisense; GTGAGCCATACTCCCGGGATTATCA
>probe:Drosophila_2:1629216_at:697:541; Interrogation_Position=2963; Antisense; GGATTATCAAGGACGCACAACCCGA
>probe:Drosophila_2:1629216_at:316:357; Interrogation_Position=2977; Antisense; GCACAACCCGAAGCCCGATAATATA
>probe:Drosophila_2:1629216_at:259:251; Interrogation_Position=3054; Antisense; CAAGGACACTTCAAAAGCGTTCTTT
>probe:Drosophila_2:1629216_at:592:119; Interrogation_Position=3069; Antisense; AGCGTTCTTTACTTCTAATATCTTA
>probe:Drosophila_2:1629216_at:554:163; Interrogation_Position=3164; Antisense; AAATTTAGATCTTTCCTGCTGGTAT
>probe:Drosophila_2:1629216_at:6:623; Interrogation_Position=3191; Antisense; TGCTGGCCGCCACGAGAAAACTGGT
>probe:Drosophila_2:1629216_at:632:591; Interrogation_Position=3212; Antisense; TGGTGGCTCAGAATCCTAAGTCTTG

Paste this into a BLAST search page for me
AAAAAACATCCCCAAGCAGCTTCGTAAGCAGCTTCGTCCTGTGAATGCGCCTGTGAATGCGCTTTGTGCTTTAAAAAGCCTTCCGAAAAAGCTCAAGTGCAATCAGCAGTTCAGTGGTCTCCGGAGATTCGTGTTGGTGGTGAGCCATACGTGAGCCATACTCCCGGGATTATCAGGATTATCAAGGACGCACAACCCGAGCACAACCCGAAGCCCGATAATATACAAGGACACTTCAAAAGCGTTCTTTAGCGTTCTTTACTTCTAATATCTTAAAATTTAGATCTTTCCTGCTGGTATTGCTGGCCGCCACGAGAAAACTGGTTGGTGGCTCAGAATCCTAAGTCTTG

Full Affymetrix probeset data:

Annotations for 1629216_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime