Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629218_at:

>probe:Drosophila_2:1629218_at:567:101; Interrogation_Position=2685; Antisense; AGACCAGTTCGCAGTGGCGGCGGCT
>probe:Drosophila_2:1629218_at:145:719; Interrogation_Position=2709; Antisense; TTCCGTGGCGGCAAGGCAGGTCGAG
>probe:Drosophila_2:1629218_at:99:707; Interrogation_Position=2779; Antisense; TTACGGCTGGCGGTGGACCTAATGC
>probe:Drosophila_2:1629218_at:538:657; Interrogation_Position=2840; Antisense; TAAGATGGGACAACTGGCGTCGTAT
>probe:Drosophila_2:1629218_at:326:159; Interrogation_Position=2849; Antisense; ACAACTGGCGTCGTATTTCGTTTGA
>probe:Drosophila_2:1629218_at:133:329; Interrogation_Position=2856; Antisense; GCGTCGTATTTCGTTTGAGGACACT
>probe:Drosophila_2:1629218_at:276:637; Interrogation_Position=2866; Antisense; TCGTTTGAGGACACTGAATTGCATT
>probe:Drosophila_2:1629218_at:150:397; Interrogation_Position=2875; Antisense; GACACTGAATTGCATTTAGAAGAAC
>probe:Drosophila_2:1629218_at:356:183; Interrogation_Position=2950; Antisense; AAAATTTCCATTTCATTCTGTCTTT
>probe:Drosophila_2:1629218_at:419:717; Interrogation_Position=2955; Antisense; TTCCATTTCATTCTGTCTTTAAGGG
>probe:Drosophila_2:1629218_at:657:209; Interrogation_Position=3086; Antisense; AAGCAACTTAATGAAATCTCGTGTA
>probe:Drosophila_2:1629218_at:554:393; Interrogation_Position=3098; Antisense; GAAATCTCGTGTAACTTGGAACTAT
>probe:Drosophila_2:1629218_at:627:381; Interrogation_Position=3116; Antisense; GAACTATTTTATGGTAAGAAGCTAC
>probe:Drosophila_2:1629218_at:510:377; Interrogation_Position=3133; Antisense; GAAGCTACCAATTCCAAAAAATCTT

Paste this into a BLAST search page for me
AGACCAGTTCGCAGTGGCGGCGGCTTTCCGTGGCGGCAAGGCAGGTCGAGTTACGGCTGGCGGTGGACCTAATGCTAAGATGGGACAACTGGCGTCGTATACAACTGGCGTCGTATTTCGTTTGAGCGTCGTATTTCGTTTGAGGACACTTCGTTTGAGGACACTGAATTGCATTGACACTGAATTGCATTTAGAAGAACAAAATTTCCATTTCATTCTGTCTTTTTCCATTTCATTCTGTCTTTAAGGGAAGCAACTTAATGAAATCTCGTGTAGAAATCTCGTGTAACTTGGAACTATGAACTATTTTATGGTAAGAAGCTACGAAGCTACCAATTCCAAAAAATCTT

Full Affymetrix probeset data:

Annotations for 1629218_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime