Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629220_at:

>probe:Drosophila_2:1629220_at:680:331; Interrogation_Position=123; Antisense; GCTGGCCAGCTCCACAGTGAAGTTG
>probe:Drosophila_2:1629220_at:603:373; Interrogation_Position=141; Antisense; GAAGTTGGCCCAAGGAACGCTCTGC
>probe:Drosophila_2:1629220_at:289:483; Interrogation_Position=207; Antisense; GTATAATCCCGTGATTCCACACAAG
>probe:Drosophila_2:1629220_at:636:235; Interrogation_Position=271; Antisense; AATCCCCTGCAGTTTGTCCAGGAGT
>probe:Drosophila_2:1629220_at:28:455; Interrogation_Position=307; Antisense; GATAACTCGATATCGGAACCGCTGC
>probe:Drosophila_2:1629220_at:103:515; Interrogation_Position=365; Antisense; GTGTACTCAATTCCCTGGCTGAAGT
>probe:Drosophila_2:1629220_at:721:575; Interrogation_Position=395; Antisense; GGCGAACTCGCCAACGGCAAGGAAT
>probe:Drosophila_2:1629220_at:469:427; Interrogation_Position=466; Antisense; GAGTACTGCTCCGTGGTCAGAAATT
>probe:Drosophila_2:1629220_at:430:705; Interrogation_Position=489; Antisense; TTAGGCCTCCTAATGCGAAAATCAT
>probe:Drosophila_2:1629220_at:608:387; Interrogation_Position=505; Antisense; GAAAATCATTGACCCCAACTGACCT
>probe:Drosophila_2:1629220_at:74:195; Interrogation_Position=521; Antisense; AACTGACCTGGTCGACGCGATTATC
>probe:Drosophila_2:1629220_at:85:411; Interrogation_Position=534; Antisense; GACGCGATTATCTCTGGATCTGGTT
>probe:Drosophila_2:1629220_at:592:341; Interrogation_Position=604; Antisense; GCTTGTTGCATGTTACTCTTTACGA
>probe:Drosophila_2:1629220_at:661:275; Interrogation_Position=96; Antisense; CTTCATCTCGATGGTGGCCGTGATT

Paste this into a BLAST search page for me
GCTGGCCAGCTCCACAGTGAAGTTGGAAGTTGGCCCAAGGAACGCTCTGCGTATAATCCCGTGATTCCACACAAGAATCCCCTGCAGTTTGTCCAGGAGTGATAACTCGATATCGGAACCGCTGCGTGTACTCAATTCCCTGGCTGAAGTGGCGAACTCGCCAACGGCAAGGAATGAGTACTGCTCCGTGGTCAGAAATTTTAGGCCTCCTAATGCGAAAATCATGAAAATCATTGACCCCAACTGACCTAACTGACCTGGTCGACGCGATTATCGACGCGATTATCTCTGGATCTGGTTGCTTGTTGCATGTTACTCTTTACGACTTCATCTCGATGGTGGCCGTGATT

Full Affymetrix probeset data:

Annotations for 1629220_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime