Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629221_at:

>probe:Drosophila_2:1629221_at:530:565; Interrogation_Position=1214; Antisense; GGCAGTCCCTACGAAGGCGGCAAGT
>probe:Drosophila_2:1629221_at:475:469; Interrogation_Position=1246; Antisense; GTTCATATACTTCCCGGAGCGATAT
>probe:Drosophila_2:1629221_at:267:185; Interrogation_Position=1304; Antisense; AAAATCCTGCATCCGAATGTTTCGC
>probe:Drosophila_2:1629221_at:112:557; Interrogation_Position=1336; Antisense; GGACGTGGGCATCGACATCTTCCAG
>probe:Drosophila_2:1629221_at:575:159; Interrogation_Position=1365; Antisense; ACAACTGGTCTCTGGCGCTGAACGT
>probe:Drosophila_2:1629221_at:206:223; Interrogation_Position=1394; Antisense; AAGGTGCTGCTTTCTGTGCAGAGCC
>probe:Drosophila_2:1629221_at:262:481; Interrogation_Position=1432; Antisense; GTATACCGAAGTCTGCATGGAGCCT
>probe:Drosophila_2:1629221_at:698:553; Interrogation_Position=1450; Antisense; GGAGCCTGAACTTGGATACATCTAT
>probe:Drosophila_2:1629221_at:441:29; Interrogation_Position=1465; Antisense; ATACATCTATGAGCACGAGCGCGAA
>probe:Drosophila_2:1629221_at:578:169; Interrogation_Position=1488; Antisense; AAAGGTTCGAGCAACTGGTGCGCGC
>probe:Drosophila_2:1629221_at:375:419; Interrogation_Position=1538; Antisense; GAGCTAATTGCACCGCGCTAGAAGA
>probe:Drosophila_2:1629221_at:263:705; Interrogation_Position=1641; Antisense; TTAGCTTAGTTGTGCCATCTGGATT
>probe:Drosophila_2:1629221_at:645:589; Interrogation_Position=1660; Antisense; TGGATTGTTTATTTTGGCCTCCCCT
>probe:Drosophila_2:1629221_at:194:283; Interrogation_Position=1695; Antisense; CTGCGCTCCAGGTTGAAACGTAGTC

Paste this into a BLAST search page for me
GGCAGTCCCTACGAAGGCGGCAAGTGTTCATATACTTCCCGGAGCGATATAAAATCCTGCATCCGAATGTTTCGCGGACGTGGGCATCGACATCTTCCAGACAACTGGTCTCTGGCGCTGAACGTAAGGTGCTGCTTTCTGTGCAGAGCCGTATACCGAAGTCTGCATGGAGCCTGGAGCCTGAACTTGGATACATCTATATACATCTATGAGCACGAGCGCGAAAAAGGTTCGAGCAACTGGTGCGCGCGAGCTAATTGCACCGCGCTAGAAGATTAGCTTAGTTGTGCCATCTGGATTTGGATTGTTTATTTTGGCCTCCCCTCTGCGCTCCAGGTTGAAACGTAGTC

Full Affymetrix probeset data:

Annotations for 1629221_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime