Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629222_at:

>probe:Drosophila_2:1629222_at:127:49; Interrogation_Position=1019; Antisense; ATGCCATCGTGTGCAACATCGGCCA
>probe:Drosophila_2:1629222_at:549:295; Interrogation_Position=1053; Antisense; CGAGATCGACGTGGACTGGCTAAAC
>probe:Drosophila_2:1629222_at:386:379; Interrogation_Position=1104; Antisense; GAAGCCCCAAGTAGATCGGTACACA
>probe:Drosophila_2:1629222_at:37:435; Interrogation_Position=1134; Antisense; GAGTGGCAAGCACATCATCCTGCTG
>probe:Drosophila_2:1629222_at:453:497; Interrogation_Position=1169; Antisense; GTCTGGTGAACCTGGGCTGTGCCCA
>probe:Drosophila_2:1629222_at:332:321; Interrogation_Position=1243; Antisense; GCCCAGATCGAGCTGTGGACCAAGT
>probe:Drosophila_2:1629222_at:472:487; Interrogation_Position=1259; Antisense; GGACCAAGTCCGACAAGTACGCCGT
>probe:Drosophila_2:1629222_at:525:81; Interrogation_Position=1319; Antisense; AGGTGGCCAGTCTTCATCTGGAGAA
>probe:Drosophila_2:1629222_at:701:603; Interrogation_Position=1367; Antisense; TGACGGAGAAGCAGGCCACCTACTT
>probe:Drosophila_2:1629222_at:686:203; Interrogation_Position=1417; Antisense; AAGCCCGACCATTACCGGTACTGAG
>probe:Drosophila_2:1629222_at:320:407; Interrogation_Position=1507; Antisense; GACGGACCCACACTAGTTATCTATT
>probe:Drosophila_2:1629222_at:493:691; Interrogation_Position=1528; Antisense; TATTGTCTGCGCATTTCACTGTTCA
>probe:Drosophila_2:1629222_at:550:285; Interrogation_Position=1546; Antisense; CTGTTCACCTAAGCAGCTCCAATAA
>probe:Drosophila_2:1629222_at:555:239; Interrogation_Position=1566; Antisense; AATAAAAACCCATCTCACGTACTCT

Paste this into a BLAST search page for me
ATGCCATCGTGTGCAACATCGGCCACGAGATCGACGTGGACTGGCTAAACGAAGCCCCAAGTAGATCGGTACACAGAGTGGCAAGCACATCATCCTGCTGGTCTGGTGAACCTGGGCTGTGCCCAGCCCAGATCGAGCTGTGGACCAAGTGGACCAAGTCCGACAAGTACGCCGTAGGTGGCCAGTCTTCATCTGGAGAATGACGGAGAAGCAGGCCACCTACTTAAGCCCGACCATTACCGGTACTGAGGACGGACCCACACTAGTTATCTATTTATTGTCTGCGCATTTCACTGTTCACTGTTCACCTAAGCAGCTCCAATAAAATAAAAACCCATCTCACGTACTCT

Full Affymetrix probeset data:

Annotations for 1629222_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime