FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629224_at:

>probe:Drosophila_2:1629224_at:630:447; Interrogation_Position=1005; Antisense; GATGCCCAGGGCGTTTGAAGATGAA
>probe:Drosophila_2:1629224_at:305:57; Interrogation_Position=1076; Antisense; ATGAGGAGAGCTACTTTGTGGCCGC
>probe:Drosophila_2:1629224_at:49:235; Interrogation_Position=1123; Antisense; AATGCCGTGCAGCAGTCCTCAGAGT
>probe:Drosophila_2:1629224_at:307:87; Interrogation_Position=1136; Antisense; AGTCCTCAGAGTCCGGCTCGTTGGT
>probe:Drosophila_2:1629224_at:131:583; Interrogation_Position=1180; Antisense; TGGCGCCAGTTCCAGCAGGAACAGC
>probe:Drosophila_2:1629224_at:469:73; Interrogation_Position=1196; Antisense; AGGAACAGCGCAACCGTCGCCGAAT
>probe:Drosophila_2:1629224_at:32:123; Interrogation_Position=1232; Antisense; AGCGTGAGCACAACCAGCGGATCAG
>probe:Drosophila_2:1629224_at:456:375; Interrogation_Position=1287; Antisense; GAAGCGAAGCCAGCAACGCTTGCGC
>probe:Drosophila_2:1629224_at:142:189; Interrogation_Position=1322; Antisense; AACAGAGCCGTAAGCGCGTCTCACA
>probe:Drosophila_2:1629224_at:453:153; Interrogation_Position=1361; Antisense; ACAGGAACCGTTCCAAGGCCCAGCG
>probe:Drosophila_2:1629224_at:108:125; Interrogation_Position=1382; Antisense; AGCGCCAGCGCCAGAGGAGGAACAA
>probe:Drosophila_2:1629224_at:653:73; Interrogation_Position=1399; Antisense; AGGAACAACATGAACCGTCGTCGCC
>probe:Drosophila_2:1629224_at:159:639; Interrogation_Position=1500; Antisense; TCGTGGCGGACGTCGCAACTAAGGA
>probe:Drosophila_2:1629224_at:303:657; Interrogation_Position=1519; Antisense; TAAGGAGTTGATCCCAGATCCCCAA

Paste this into a BLAST search page for me
GATGCCCAGGGCGTTTGAAGATGAAATGAGGAGAGCTACTTTGTGGCCGCAATGCCGTGCAGCAGTCCTCAGAGTAGTCCTCAGAGTCCGGCTCGTTGGTTGGCGCCAGTTCCAGCAGGAACAGCAGGAACAGCGCAACCGTCGCCGAATAGCGTGAGCACAACCAGCGGATCAGGAAGCGAAGCCAGCAACGCTTGCGCAACAGAGCCGTAAGCGCGTCTCACAACAGGAACCGTTCCAAGGCCCAGCGAGCGCCAGCGCCAGAGGAGGAACAAAGGAACAACATGAACCGTCGTCGCCTCGTGGCGGACGTCGCAACTAAGGATAAGGAGTTGATCCCAGATCCCCAA

Full Affymetrix probeset data:

Annotations for 1629224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720