Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629225_s_at:

>probe:Drosophila_2:1629225_s_at:562:35; Interrogation_Position=110; Antisense; ATCAGTGGTGGCAGGACGAGCCCAA
>probe:Drosophila_2:1629225_s_at:569:67; Interrogation_Position=13; Antisense; ATGGCACAAAACAAGCAGCGCGCTG
>probe:Drosophila_2:1629225_s_at:356:201; Interrogation_Position=158; Antisense; AACCCGGCGGATGCACATTGTTAGG
>probe:Drosophila_2:1629225_s_at:192:547; Interrogation_Position=166; Antisense; GGATGCACATTGTTAGGCCCAGCCA
>probe:Drosophila_2:1629225_s_at:54:3; Interrogation_Position=174; Antisense; ATTGTTAGGCCCAGCCAGTGGAATT
>probe:Drosophila_2:1629225_s_at:580:261; Interrogation_Position=185; Antisense; CAGCCAGTGGAATTGGATTGGACAC
>probe:Drosophila_2:1629225_s_at:186:3; Interrogation_Position=201; Antisense; ATTGGACACGGGATATGGCCACGGT
>probe:Drosophila_2:1629225_s_at:486:457; Interrogation_Position=212; Antisense; GATATGGCCACGGTGCTGCAGCGAT
>probe:Drosophila_2:1629225_s_at:409:617; Interrogation_Position=228; Antisense; TGCAGCGATGCCAAATCAACGGACT
>probe:Drosophila_2:1629225_s_at:539:239; Interrogation_Position=241; Antisense; AATCAACGGACTCGTCGTCGAGACG
>probe:Drosophila_2:1629225_s_at:360:425; Interrogation_Position=260; Antisense; GAGACGCCTCAGCTGCCCCAGAAGA
>probe:Drosophila_2:1629225_s_at:659:323; Interrogation_Position=32; Antisense; GCGCTGCGACTCACTCCCAAAAAGA
>probe:Drosophila_2:1629225_s_at:247:357; Interrogation_Position=82; Antisense; GCAAACCGAATGTGGAGGACAACGA
>probe:Drosophila_2:1629225_s_at:441:559; Interrogation_Position=98; Antisense; GGACAACGACGAATCAGTGGTGGCA

Paste this into a BLAST search page for me
ATCAGTGGTGGCAGGACGAGCCCAAATGGCACAAAACAAGCAGCGCGCTGAACCCGGCGGATGCACATTGTTAGGGGATGCACATTGTTAGGCCCAGCCAATTGTTAGGCCCAGCCAGTGGAATTCAGCCAGTGGAATTGGATTGGACACATTGGACACGGGATATGGCCACGGTGATATGGCCACGGTGCTGCAGCGATTGCAGCGATGCCAAATCAACGGACTAATCAACGGACTCGTCGTCGAGACGGAGACGCCTCAGCTGCCCCAGAAGAGCGCTGCGACTCACTCCCAAAAAGAGCAAACCGAATGTGGAGGACAACGAGGACAACGACGAATCAGTGGTGGCA

Full Affymetrix probeset data:

Annotations for 1629225_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime