FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629226_at:

>probe:Drosophila_2:1629226_at:719:541; Interrogation_Position=15; Antisense; GGTTCCTTACTGCATGTCGGTGAGA
>probe:Drosophila_2:1629226_at:616:429; Interrogation_Position=166; Antisense; GAGTATACTGCTGAGGCTGACCCTA
>probe:Drosophila_2:1629226_at:298:439; Interrogation_Position=178; Antisense; GAGGCTGACCCTAACCCGGAAGTAG
>probe:Drosophila_2:1629226_at:682:371; Interrogation_Position=202; Antisense; GAAGTTGTGACCGAGGTGGACCCTC
>probe:Drosophila_2:1629226_at:504:531; Interrogation_Position=216; Antisense; GGTGGACCCTCTGGCAGAAGTTGAA
>probe:Drosophila_2:1629226_at:362:521; Interrogation_Position=245; Antisense; GGGCCAAGGCTGACCCTAATACAGA
>probe:Drosophila_2:1629226_at:545:141; Interrogation_Position=277; Antisense; GTTTTGGCCGAAGCTGACCCTAATA
>probe:Drosophila_2:1629226_at:117:269; Interrogation_Position=310; Antisense; GAAGTTTTTGCTGAGGCTTACCCTA
>probe:Drosophila_2:1629226_at:402:57; Interrogation_Position=395; Antisense; ATGATATGGCTGATGCTGACCCTAT
>probe:Drosophila_2:1629226_at:105:53; Interrogation_Position=407; Antisense; ATGCTGACCCTATGACCGAGGTTGA
>probe:Drosophila_2:1629226_at:244:373; Interrogation_Position=430; Antisense; GAAGTGATGGCCGTAGCTGACCCTA
>probe:Drosophila_2:1629226_at:22:695; Interrogation_Position=507; Antisense; TTTCGCTGAAGCTGACCCTAAGGTT
>probe:Drosophila_2:1629226_at:539:363; Interrogation_Position=51; Antisense; GAATAGCCGGCATCGCGTGCAGAAT
>probe:Drosophila_2:1629226_at:112:147; Interrogation_Position=98; Antisense; ACTCTGTTCAGGATGAGGCTACTCC

Paste this into a BLAST search page for me
GGTTCCTTACTGCATGTCGGTGAGAGAGTATACTGCTGAGGCTGACCCTAGAGGCTGACCCTAACCCGGAAGTAGGAAGTTGTGACCGAGGTGGACCCTCGGTGGACCCTCTGGCAGAAGTTGAAGGGCCAAGGCTGACCCTAATACAGAGTTTTGGCCGAAGCTGACCCTAATAGAAGTTTTTGCTGAGGCTTACCCTAATGATATGGCTGATGCTGACCCTATATGCTGACCCTATGACCGAGGTTGAGAAGTGATGGCCGTAGCTGACCCTATTTCGCTGAAGCTGACCCTAAGGTTGAATAGCCGGCATCGCGTGCAGAATACTCTGTTCAGGATGAGGCTACTCC

Full Affymetrix probeset data:

Annotations for 1629226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720