Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629227_at:

>probe:Drosophila_2:1629227_at:281:279; Interrogation_Position=4943; Antisense; CTAGACGTTTTCTTGCTAAGCGGAA
>probe:Drosophila_2:1629227_at:468:271; Interrogation_Position=4998; Antisense; CATCATAATTTCATGGTCCAAGTGG
>probe:Drosophila_2:1629227_at:350:365; Interrogation_Position=5060; Antisense; GAATACTACTTGGTTTCATTGGATT
>probe:Drosophila_2:1629227_at:100:541; Interrogation_Position=5071; Antisense; GGTTTCATTGGATTTCCAACCTATT
>probe:Drosophila_2:1629227_at:312:397; Interrogation_Position=5106; Antisense; GACACACGTCTATATTAAGTTCACA
>probe:Drosophila_2:1629227_at:503:91; Interrogation_Position=5201; Antisense; AGTATTCCCGTAAAGCGCTATCAAT
>probe:Drosophila_2:1629227_at:621:323; Interrogation_Position=5215; Antisense; GCGCTATCAATTTGTCGAGTGCTTA
>probe:Drosophila_2:1629227_at:310:231; Interrogation_Position=5251; Antisense; AATGATCGTATTAAGCTTTAGCTCT
>probe:Drosophila_2:1629227_at:512:341; Interrogation_Position=5265; Antisense; GCTTTAGCTCTAAGTCCAAGTCAAA
>probe:Drosophila_2:1629227_at:726:503; Interrogation_Position=5278; Antisense; GTCCAAGTCAAACGCCTTTGTACAT
>probe:Drosophila_2:1629227_at:33:601; Interrogation_Position=5296; Antisense; TGTACATAACTAGTTTACCCAAAAG
>probe:Drosophila_2:1629227_at:192:249; Interrogation_Position=5350; Antisense; CCAAAAGTTTTGGACCTACACTGCG
>probe:Drosophila_2:1629227_at:326:277; Interrogation_Position=5365; Antisense; CTACACTGCGAAAGGTCTTAACAAT
>probe:Drosophila_2:1629227_at:516:537; Interrogation_Position=5378; Antisense; GGTCTTAACAATTTCCATTGTCATT

Paste this into a BLAST search page for me
CTAGACGTTTTCTTGCTAAGCGGAACATCATAATTTCATGGTCCAAGTGGGAATACTACTTGGTTTCATTGGATTGGTTTCATTGGATTTCCAACCTATTGACACACGTCTATATTAAGTTCACAAGTATTCCCGTAAAGCGCTATCAATGCGCTATCAATTTGTCGAGTGCTTAAATGATCGTATTAAGCTTTAGCTCTGCTTTAGCTCTAAGTCCAAGTCAAAGTCCAAGTCAAACGCCTTTGTACATTGTACATAACTAGTTTACCCAAAAGCCAAAAGTTTTGGACCTACACTGCGCTACACTGCGAAAGGTCTTAACAATGGTCTTAACAATTTCCATTGTCATT

Full Affymetrix probeset data:

Annotations for 1629227_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime