FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629228_at:

>probe:Drosophila_2:1629228_at:38:211; Interrogation_Position=5018; Antisense; AAGCAAGACTGAAGGTCCTCCGCAG
>probe:Drosophila_2:1629228_at:167:373; Interrogation_Position=5028; Antisense; GAAGGTCCTCCGCAGAATATTTTAT
>probe:Drosophila_2:1629228_at:62:365; Interrogation_Position=5042; Antisense; GAATATTTTATTCTCCTACATTTTT
>probe:Drosophila_2:1629228_at:437:259; Interrogation_Position=5079; Antisense; CACTGAGTTGTTTTGAATTCTGTAA
>probe:Drosophila_2:1629228_at:372:489; Interrogation_Position=5181; Antisense; GTACATTAACCGAAATCCAGGAAAG
>probe:Drosophila_2:1629228_at:252:89; Interrogation_Position=5291; Antisense; AGTCACATTTTGTCCTCTAACTTCA
>probe:Drosophila_2:1629228_at:106:503; Interrogation_Position=5302; Antisense; GTCCTCTAACTTCAACTAAGCCAAT
>probe:Drosophila_2:1629228_at:223:659; Interrogation_Position=5318; Antisense; TAAGCCAATTGCATACGAAATACAT
>probe:Drosophila_2:1629228_at:234:477; Interrogation_Position=5350; Antisense; GTTTAACTCAACTCTAGATCCTCCA
>probe:Drosophila_2:1629228_at:489:193; Interrogation_Position=5359; Antisense; AACTCTAGATCCTCCATTGATATTG
>probe:Drosophila_2:1629228_at:442:689; Interrogation_Position=5413; Antisense; TATTGTCTACTTAAATTGAACGTGC
>probe:Drosophila_2:1629228_at:470:383; Interrogation_Position=5430; Antisense; GAACGTGCAAAACTCAACAACTATA
>probe:Drosophila_2:1629228_at:17:35; Interrogation_Position=5468; Antisense; ATCAACTCTCTATTTCTTTAACTTT
>probe:Drosophila_2:1629228_at:213:59; Interrogation_Position=5506; Antisense; ATGATAACTCAACTCTTACAACTTA

Paste this into a BLAST search page for me
AAGCAAGACTGAAGGTCCTCCGCAGGAAGGTCCTCCGCAGAATATTTTATGAATATTTTATTCTCCTACATTTTTCACTGAGTTGTTTTGAATTCTGTAAGTACATTAACCGAAATCCAGGAAAGAGTCACATTTTGTCCTCTAACTTCAGTCCTCTAACTTCAACTAAGCCAATTAAGCCAATTGCATACGAAATACATGTTTAACTCAACTCTAGATCCTCCAAACTCTAGATCCTCCATTGATATTGTATTGTCTACTTAAATTGAACGTGCGAACGTGCAAAACTCAACAACTATAATCAACTCTCTATTTCTTTAACTTTATGATAACTCAACTCTTACAACTTA

Full Affymetrix probeset data:

Annotations for 1629228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720