FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629230_at:

>probe:Drosophila_2:1629230_at:333:639; Interrogation_Position=104; Antisense; TCGGAACATCAGTTGCAATGGTGCA
>probe:Drosophila_2:1629230_at:322:535; Interrogation_Position=123; Antisense; GGTGCAGATCAAATTCCTTTTCGTC
>probe:Drosophila_2:1629230_at:147:717; Interrogation_Position=136; Antisense; TTCCTTTTCGTCTTCCTGGCTGTGA
>probe:Drosophila_2:1629230_at:219:613; Interrogation_Position=161; Antisense; TGACAATTGTTGTCCTGGCCGCCAA
>probe:Drosophila_2:1629230_at:277:577; Interrogation_Position=177; Antisense; GGCCGCCAATATGGCTGATGCCGAT
>probe:Drosophila_2:1629230_at:428:447; Interrogation_Position=193; Antisense; GATGCCGATTGCCTTTCCGGCAAAT
>probe:Drosophila_2:1629230_at:406:693; Interrogation_Position=206; Antisense; TTTCCGGCAAATACAAGGGTCCCTG
>probe:Drosophila_2:1629230_at:63:639; Interrogation_Position=236; Antisense; TCTGGGACAACGAGATGTGCCGACG
>probe:Drosophila_2:1629230_at:617:99; Interrogation_Position=248; Antisense; AGATGTGCCGACGTATTTGCAAGGA
>probe:Drosophila_2:1629230_at:384:515; Interrogation_Position=26; Antisense; GTGTAGTCCTATATAAGCGTCCCCA
>probe:Drosophila_2:1629230_at:559:31; Interrogation_Position=38; Antisense; ATAAGCGTCCCCACAAGCTGTCGAT
>probe:Drosophila_2:1629230_at:310:251; Interrogation_Position=51; Antisense; CAAGCTGTCGATACCAAACGTCTTC
>probe:Drosophila_2:1629230_at:239:127; Interrogation_Position=63; Antisense; ACCAAACGTCTTCGAGAACTCAAGT
>probe:Drosophila_2:1629230_at:72:167; Interrogation_Position=88; Antisense; AAAGTACCAGACTCGTTCGGAACAT

Paste this into a BLAST search page for me
TCGGAACATCAGTTGCAATGGTGCAGGTGCAGATCAAATTCCTTTTCGTCTTCCTTTTCGTCTTCCTGGCTGTGATGACAATTGTTGTCCTGGCCGCCAAGGCCGCCAATATGGCTGATGCCGATGATGCCGATTGCCTTTCCGGCAAATTTTCCGGCAAATACAAGGGTCCCTGTCTGGGACAACGAGATGTGCCGACGAGATGTGCCGACGTATTTGCAAGGAGTGTAGTCCTATATAAGCGTCCCCAATAAGCGTCCCCACAAGCTGTCGATCAAGCTGTCGATACCAAACGTCTTCACCAAACGTCTTCGAGAACTCAAGTAAAGTACCAGACTCGTTCGGAACAT

Full Affymetrix probeset data:

Annotations for 1629230_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720