FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629232_at:

>probe:Drosophila_2:1629232_at:647:509; Interrogation_Position=2276; Antisense; GTGCATCCTCGGCATCAGATTGCTA
>probe:Drosophila_2:1629232_at:701:79; Interrogation_Position=2315; Antisense; AGTGGTTTCGTTGGACGACCATCTT
>probe:Drosophila_2:1629232_at:475:569; Interrogation_Position=2374; Antisense; GGCATTGCTAATGTCGAGTCCTGGC
>probe:Drosophila_2:1629232_at:103:619; Interrogation_Position=2392; Antisense; TCCTGGCGCAAAGGTGGTCGTGCAA
>probe:Drosophila_2:1629232_at:525:417; Interrogation_Position=2482; Antisense; GAGCGACGAGAACAGGTCCTCAACA
>probe:Drosophila_2:1629232_at:606:397; Interrogation_Position=2514; Antisense; GACAAGACGTCCCAGGCAGTTGCAA
>probe:Drosophila_2:1629232_at:450:71; Interrogation_Position=2527; Antisense; AGGCAGTTGCAACCGTACGATTTCA
>probe:Drosophila_2:1629232_at:203:651; Interrogation_Position=2542; Antisense; TACGATTTCAAGATTACCCACCCTA
>probe:Drosophila_2:1629232_at:20:709; Interrogation_Position=2555; Antisense; TTACCCACCCTATTGGAGGAGCAGG
>probe:Drosophila_2:1629232_at:381:155; Interrogation_Position=2635; Antisense; ACACGAGCTGGAACGGTTTCCGGAT
>probe:Drosophila_2:1629232_at:24:289; Interrogation_Position=2655; Antisense; CGGATTTGGAGGTACACTTGGAACT
>probe:Drosophila_2:1629232_at:360:725; Interrogation_Position=2681; Antisense; TTGAGGAACTCCTGGACCCTGTTGC
>probe:Drosophila_2:1629232_at:446:287; Interrogation_Position=2739; Antisense; CTGGCAATACCAGTTGACTTGTGAT
>probe:Drosophila_2:1629232_at:636:167; Interrogation_Position=2822; Antisense; AAATGTTTACACTTCTCCGTGATTA

Paste this into a BLAST search page for me
GTGCATCCTCGGCATCAGATTGCTAAGTGGTTTCGTTGGACGACCATCTTGGCATTGCTAATGTCGAGTCCTGGCTCCTGGCGCAAAGGTGGTCGTGCAAGAGCGACGAGAACAGGTCCTCAACAGACAAGACGTCCCAGGCAGTTGCAAAGGCAGTTGCAACCGTACGATTTCATACGATTTCAAGATTACCCACCCTATTACCCACCCTATTGGAGGAGCAGGACACGAGCTGGAACGGTTTCCGGATCGGATTTGGAGGTACACTTGGAACTTTGAGGAACTCCTGGACCCTGTTGCCTGGCAATACCAGTTGACTTGTGATAAATGTTTACACTTCTCCGTGATTA

Full Affymetrix probeset data:

Annotations for 1629232_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720