FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629234_at:

>probe:Drosophila_2:1629234_at:25:569; Interrogation_Position=766; Antisense; GGCAGATGCGTCATCTCAAGAGCTT
>probe:Drosophila_2:1629234_at:130:623; Interrogation_Position=772; Antisense; TGCGTCATCTCAAGAGCTTCTTTGA
>probe:Drosophila_2:1629234_at:132:419; Interrogation_Position=785; Antisense; GAGCTTCTTTGAGGCCAAGAAACTG
>probe:Drosophila_2:1629234_at:691:251; Interrogation_Position=800; Antisense; CAAGAAACTGGTGTGAGGTGCTCCG
>probe:Drosophila_2:1629234_at:9:141; Interrogation_Position=847; Antisense; ACTGGCCAACCACTGGCCTCATTGT
>probe:Drosophila_2:1629234_at:42:143; Interrogation_Position=858; Antisense; ACTGGCCTCATTGTTCCGTGTGTTT
>probe:Drosophila_2:1629234_at:491:3; Interrogation_Position=867; Antisense; ATTGTTCCGTGTGTTTCCCTCATTT
>probe:Drosophila_2:1629234_at:636:513; Interrogation_Position=877; Antisense; GTGTTTCCCTCATTTGGCAGGAATT
>probe:Drosophila_2:1629234_at:704:567; Interrogation_Position=892; Antisense; GGCAGGAATTGCGAATTTCATCGAT
>probe:Drosophila_2:1629234_at:561:695; Interrogation_Position=907; Antisense; TTTCATCGATGGATCGTCATCCACC
>probe:Drosophila_2:1629234_at:724:439; Interrogation_Position=914; Antisense; GATGGATCGTCATCCACCCAACCAG
>probe:Drosophila_2:1629234_at:601:403; Interrogation_Position=950; Antisense; GACTCCAAGCACTTCTAGTTGTAAT
>probe:Drosophila_2:1629234_at:668:109; Interrogation_Position=957; Antisense; AGCACTTCTAGTTGTAATTTCTTGT
>probe:Drosophila_2:1629234_at:627:483; Interrogation_Position=970; Antisense; GTAATTTCTTGTGCGTAATTTAATA

Paste this into a BLAST search page for me
GGCAGATGCGTCATCTCAAGAGCTTTGCGTCATCTCAAGAGCTTCTTTGAGAGCTTCTTTGAGGCCAAGAAACTGCAAGAAACTGGTGTGAGGTGCTCCGACTGGCCAACCACTGGCCTCATTGTACTGGCCTCATTGTTCCGTGTGTTTATTGTTCCGTGTGTTTCCCTCATTTGTGTTTCCCTCATTTGGCAGGAATTGGCAGGAATTGCGAATTTCATCGATTTTCATCGATGGATCGTCATCCACCGATGGATCGTCATCCACCCAACCAGGACTCCAAGCACTTCTAGTTGTAATAGCACTTCTAGTTGTAATTTCTTGTGTAATTTCTTGTGCGTAATTTAATA

Full Affymetrix probeset data:

Annotations for 1629234_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720