Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629235_s_at:

>probe:Drosophila_2:1629235_s_at:591:255; Interrogation_Position=1029; Antisense; CAAACTCAAACTCAACTGCTTATAA
>probe:Drosophila_2:1629235_s_at:15:455; Interrogation_Position=1062; Antisense; GATCAACGATTCAAAACAACAGCCA
>probe:Drosophila_2:1629235_s_at:357:261; Interrogation_Position=1081; Antisense; CAGCCAAACATCTGAACGCCTTGAT
>probe:Drosophila_2:1629235_s_at:670:279; Interrogation_Position=1092; Antisense; CTGAACGCCTTGATGAATTATTTAT
>probe:Drosophila_2:1629235_s_at:243:109; Interrogation_Position=622; Antisense; AGAAGGCCGCTGAGTTCAACTTCCG
>probe:Drosophila_2:1629235_s_at:305:719; Interrogation_Position=642; Antisense; TTCCGCAACCAGCTCAAGGTGGTGA
>probe:Drosophila_2:1629235_s_at:400:391; Interrogation_Position=707; Antisense; GAAACCCGACTGGTCCAAGGGCAAG
>probe:Drosophila_2:1629235_s_at:549:359; Interrogation_Position=727; Antisense; GCAAGCCCGGAGATGCCAAGGTGAA
>probe:Drosophila_2:1629235_s_at:714:69; Interrogation_Position=763; Antisense; AGGCCGAAGCTTAAGTGTCCACACG
>probe:Drosophila_2:1629235_s_at:563:657; Interrogation_Position=774; Antisense; TAAGTGTCCACACGTCCACTAGTGT
>probe:Drosophila_2:1629235_s_at:338:147; Interrogation_Position=791; Antisense; ACTAGTGTCCACTGACCCGTGACTC
>probe:Drosophila_2:1629235_s_at:42:405; Interrogation_Position=811; Antisense; GACTCCCGCCCTAAACAATAATTGA
>probe:Drosophila_2:1629235_s_at:258:685; Interrogation_Position=909; Antisense; TATATGCATGTATATATCTCGCCAT
>probe:Drosophila_2:1629235_s_at:242:39; Interrogation_Position=924; Antisense; ATCTCGCCATATATATGTGTCCACA

Paste this into a BLAST search page for me
CAAACTCAAACTCAACTGCTTATAAGATCAACGATTCAAAACAACAGCCACAGCCAAACATCTGAACGCCTTGATCTGAACGCCTTGATGAATTATTTATAGAAGGCCGCTGAGTTCAACTTCCGTTCCGCAACCAGCTCAAGGTGGTGAGAAACCCGACTGGTCCAAGGGCAAGGCAAGCCCGGAGATGCCAAGGTGAAAGGCCGAAGCTTAAGTGTCCACACGTAAGTGTCCACACGTCCACTAGTGTACTAGTGTCCACTGACCCGTGACTCGACTCCCGCCCTAAACAATAATTGATATATGCATGTATATATCTCGCCATATCTCGCCATATATATGTGTCCACA

Full Affymetrix probeset data:

Annotations for 1629235_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime