FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629237_at:

>probe:Drosophila_2:1629237_at:183:219; Interrogation_Position=1859; Antisense; AAGTAATGCTCCCTTACGACTACAG
>probe:Drosophila_2:1629237_at:283:655; Interrogation_Position=1892; Antisense; TAATATCGTCTTACACTCTGAACAT
>probe:Drosophila_2:1629237_at:21:515; Interrogation_Position=1922; Antisense; GTGTCAGGAGTACATTTGGCTACTT
>probe:Drosophila_2:1629237_at:246:455; Interrogation_Position=1963; Antisense; GATAAGCCGTCACTAACCATACAAC
>probe:Drosophila_2:1629237_at:495:465; Interrogation_Position=2042; Antisense; GATTGGTCTTCTGTTTTGGTCATAC
>probe:Drosophila_2:1629237_at:434:495; Interrogation_Position=2060; Antisense; GTCATACACGGATTGATTCATGCGA
>probe:Drosophila_2:1629237_at:458:657; Interrogation_Position=2133; Antisense; TAATGTGACTCACCTTTCCAACGAT
>probe:Drosophila_2:1629237_at:33:371; Interrogation_Position=2172; Antisense; GAAGGTATTGTATGCTTTCCAGTCC
>probe:Drosophila_2:1629237_at:534:51; Interrogation_Position=2183; Antisense; ATGCTTTCCAGTCCTGTGTCTGAAA
>probe:Drosophila_2:1629237_at:650:611; Interrogation_Position=2203; Antisense; TGAAAGAGGTTTTTCCGAATCTGCC
>probe:Drosophila_2:1629237_at:523:63; Interrogation_Position=2239; Antisense; ATGTGTGCTTGTCAGTAGTCAGTCA
>probe:Drosophila_2:1629237_at:62:187; Interrogation_Position=2268; Antisense; AACAATGTTGTTTAGCTTGGCTCAA
>probe:Drosophila_2:1629237_at:210:327; Interrogation_Position=2339; Antisense; GCGAGTAGCCACTTCAGCTTATGTA
>probe:Drosophila_2:1629237_at:616:477; Interrogation_Position=2381; Antisense; GTTTGTGAGTCATGGCTTAGATCTA

Paste this into a BLAST search page for me
AAGTAATGCTCCCTTACGACTACAGTAATATCGTCTTACACTCTGAACATGTGTCAGGAGTACATTTGGCTACTTGATAAGCCGTCACTAACCATACAACGATTGGTCTTCTGTTTTGGTCATACGTCATACACGGATTGATTCATGCGATAATGTGACTCACCTTTCCAACGATGAAGGTATTGTATGCTTTCCAGTCCATGCTTTCCAGTCCTGTGTCTGAAATGAAAGAGGTTTTTCCGAATCTGCCATGTGTGCTTGTCAGTAGTCAGTCAAACAATGTTGTTTAGCTTGGCTCAAGCGAGTAGCCACTTCAGCTTATGTAGTTTGTGAGTCATGGCTTAGATCTA

Full Affymetrix probeset data:

Annotations for 1629237_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720