FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629238_at:

>probe:Drosophila_2:1629238_at:729:57; Interrogation_Position=13; Antisense; ATGAGGGTGCATCACATCCTGTGGC
>probe:Drosophila_2:1629238_at:370:581; Interrogation_Position=134; Antisense; TGGCCTACGCTAATGCTCCTCTGTA
>probe:Drosophila_2:1629238_at:221:657; Interrogation_Position=144; Antisense; TAATGCTCCTCTGTACGCCGCAGGT
>probe:Drosophila_2:1629238_at:294:601; Interrogation_Position=155; Antisense; TGTACGCCGCAGGTGGCAGCAGCCA
>probe:Drosophila_2:1629238_at:532:351; Interrogation_Position=170; Antisense; GCAGCAGCCAGGTGGATGTCCGCAA
>probe:Drosophila_2:1629238_at:689:313; Interrogation_Position=176; Antisense; GCCAGGTGGATGTCCGCAACAACTA
>probe:Drosophila_2:1629238_at:22:443; Interrogation_Position=184; Antisense; GATGTCCGCAACAACTACGACGGCA
>probe:Drosophila_2:1629238_at:555:669; Interrogation_Position=253; Antisense; TACTCCAGCCGCTATGTGTCCGGAA
>probe:Drosophila_2:1629238_at:119:153; Interrogation_Position=26; Antisense; ACATCCTGTGGCCAGGTGGCGTCAA
>probe:Drosophila_2:1629238_at:354:341; Interrogation_Position=263; Antisense; GCTATGTGTCCGGAATCCCAGCTGC
>probe:Drosophila_2:1629238_at:548:521; Interrogation_Position=41; Antisense; GTGGCGTCAAGTTGGTTCTCGCTGC
>probe:Drosophila_2:1629238_at:414:653; Interrogation_Position=47; Antisense; TCAAGTTGGTTCTCGCTGCCCTCAT
>probe:Drosophila_2:1629238_at:621:279; Interrogation_Position=78; Antisense; CTCTGCGGCCAAACCAGGAGTTGTA
>probe:Drosophila_2:1629238_at:211:267; Interrogation_Position=92; Antisense; CAGGAGTTGTAGCTCCACTGGCTGC

Paste this into a BLAST search page for me
ATGAGGGTGCATCACATCCTGTGGCTGGCCTACGCTAATGCTCCTCTGTATAATGCTCCTCTGTACGCCGCAGGTTGTACGCCGCAGGTGGCAGCAGCCAGCAGCAGCCAGGTGGATGTCCGCAAGCCAGGTGGATGTCCGCAACAACTAGATGTCCGCAACAACTACGACGGCATACTCCAGCCGCTATGTGTCCGGAAACATCCTGTGGCCAGGTGGCGTCAAGCTATGTGTCCGGAATCCCAGCTGCGTGGCGTCAAGTTGGTTCTCGCTGCTCAAGTTGGTTCTCGCTGCCCTCATCTCTGCGGCCAAACCAGGAGTTGTACAGGAGTTGTAGCTCCACTGGCTGC

Full Affymetrix probeset data:

Annotations for 1629238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720