FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629240_at:

>probe:Drosophila_2:1629240_at:356:451; Interrogation_Position=120; Antisense; GATCGTGCTGCGGATATTACTGCTG
>probe:Drosophila_2:1629240_at:522:21; Interrogation_Position=133; Antisense; ATATTACTGCTGTGGTCCCTGCTGT
>probe:Drosophila_2:1629240_at:435:595; Interrogation_Position=155; Antisense; TGTGGACCTTGTGGACCCCGATGTG
>probe:Drosophila_2:1629240_at:10:291; Interrogation_Position=187; Antisense; CGGATCCTGCTGTGGACCCTGTGGA
>probe:Drosophila_2:1629240_at:485:483; Interrogation_Position=216; Antisense; GTGGACCTTGTTGCGGACCATTTGG
>probe:Drosophila_2:1629240_at:291:129; Interrogation_Position=232; Antisense; ACCATTTGGCAGTTGTTGCGGTGGC
>probe:Drosophila_2:1629240_at:80:521; Interrogation_Position=252; Antisense; GTGGCTGTTGGTGCTAAATGCTCGC
>probe:Drosophila_2:1629240_at:421:167; Interrogation_Position=267; Antisense; AAATGCTCGCAATTGGCAGCCGAAT
>probe:Drosophila_2:1629240_at:477:353; Interrogation_Position=282; Antisense; GCAGCCGAATCGATTTGTGAAACCA
>probe:Drosophila_2:1629240_at:87:693; Interrogation_Position=30; Antisense; TTTGTTGTTTTGTCCCAAATACTTG
>probe:Drosophila_2:1629240_at:587:21; Interrogation_Position=306; Antisense; ATACCACAATCCCACCATGGTTAAA
>probe:Drosophila_2:1629240_at:82:701; Interrogation_Position=63; Antisense; TTTTGGCTTCTAAAGACCGTTGACT
>probe:Drosophila_2:1629240_at:488:211; Interrogation_Position=75; Antisense; AAGACCGTTGACTTCTCGAATTAAT
>probe:Drosophila_2:1629240_at:531:647; Interrogation_Position=99; Antisense; TCATGTGCTGTGGACCTTGTGGATC

Paste this into a BLAST search page for me
GATCGTGCTGCGGATATTACTGCTGATATTACTGCTGTGGTCCCTGCTGTTGTGGACCTTGTGGACCCCGATGTGCGGATCCTGCTGTGGACCCTGTGGAGTGGACCTTGTTGCGGACCATTTGGACCATTTGGCAGTTGTTGCGGTGGCGTGGCTGTTGGTGCTAAATGCTCGCAAATGCTCGCAATTGGCAGCCGAATGCAGCCGAATCGATTTGTGAAACCATTTGTTGTTTTGTCCCAAATACTTGATACCACAATCCCACCATGGTTAAATTTTGGCTTCTAAAGACCGTTGACTAAGACCGTTGACTTCTCGAATTAATTCATGTGCTGTGGACCTTGTGGATC

Full Affymetrix probeset data:

Annotations for 1629240_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720