FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629241_at:

>probe:Drosophila_2:1629241_at:676:383; Interrogation_Position=1007; Antisense; GAACTGATGACATTCGAGCCCGTCT
>probe:Drosophila_2:1629241_at:74:599; Interrogation_Position=1047; Antisense; TGTCCAACGCACGACTGGGTCATGT
>probe:Drosophila_2:1629241_at:10:177; Interrogation_Position=1088; Antisense; AAACGCATCTGCATCGGGACTCCAA
>probe:Drosophila_2:1629241_at:34:529; Interrogation_Position=1103; Antisense; GGGACTCCAAACTTGGTGCCACCAG
>probe:Drosophila_2:1629241_at:245:319; Interrogation_Position=1157; Antisense; GCCGAATCTCTTAGCATCGAACAGA
>probe:Drosophila_2:1629241_at:525:397; Interrogation_Position=1211; Antisense; GACAACAGCGTGGTACTACGTCCAT
>probe:Drosophila_2:1629241_at:475:239; Interrogation_Position=1355; Antisense; AATAGCGTTGGCCAATGGTCCAGTA
>probe:Drosophila_2:1629241_at:568:251; Interrogation_Position=811; Antisense; CAAGGATCACTTCATGTTCATCAGT
>probe:Drosophila_2:1629241_at:31:473; Interrogation_Position=826; Antisense; GTTCATCAGTTGCATCGACTACATC
>probe:Drosophila_2:1629241_at:482:105; Interrogation_Position=861; Antisense; AGACTGGACACTTTGGCGAGCACTC
>probe:Drosophila_2:1629241_at:85:421; Interrogation_Position=878; Antisense; GAGCACTCTAACCAGCTGTGGAGCA
>probe:Drosophila_2:1629241_at:379:651; Interrogation_Position=903; Antisense; TCACGGATGTGCCAACATGGGCCAA
>probe:Drosophila_2:1629241_at:311:523; Interrogation_Position=921; Antisense; GGGCCAAGATCAACGCGGGACTAGT
>probe:Drosophila_2:1629241_at:288:447; Interrogation_Position=985; Antisense; GATCCAGCACGTCTACTTCGGAGAA

Paste this into a BLAST search page for me
GAACTGATGACATTCGAGCCCGTCTTGTCCAACGCACGACTGGGTCATGTAAACGCATCTGCATCGGGACTCCAAGGGACTCCAAACTTGGTGCCACCAGGCCGAATCTCTTAGCATCGAACAGAGACAACAGCGTGGTACTACGTCCATAATAGCGTTGGCCAATGGTCCAGTACAAGGATCACTTCATGTTCATCAGTGTTCATCAGTTGCATCGACTACATCAGACTGGACACTTTGGCGAGCACTCGAGCACTCTAACCAGCTGTGGAGCATCACGGATGTGCCAACATGGGCCAAGGGCCAAGATCAACGCGGGACTAGTGATCCAGCACGTCTACTTCGGAGAA

Full Affymetrix probeset data:

Annotations for 1629241_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720