Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629243_at:

>probe:Drosophila_2:1629243_at:59:125; Interrogation_Position=7846; Antisense; ACACGGACTTTTCATTTCTGGCCAA
>probe:Drosophila_2:1629243_at:178:581; Interrogation_Position=7864; Antisense; TGGCCAATCTCAATCACTACTATCA
>probe:Drosophila_2:1629243_at:409:367; Interrogation_Position=7922; Antisense; GAATCGCCATGTTTACTGCAACTTG
>probe:Drosophila_2:1629243_at:449:191; Interrogation_Position=7941; Antisense; AACTTGCCAGTCCAGCAGTTGCAGG
>probe:Drosophila_2:1629243_at:676:613; Interrogation_Position=7984; Antisense; TGAAGAAATCCATCGCCACATCTAC
>probe:Drosophila_2:1629243_at:153:151; Interrogation_Position=8001; Antisense; ACATCTACAAGTCCCTGGCATGAGC
>probe:Drosophila_2:1629243_at:162:171; Interrogation_Position=8027; Antisense; AAAGGTCAAGTCGAAGCCGCTGCAG
>probe:Drosophila_2:1629243_at:329:221; Interrogation_Position=8073; Antisense; AAGTGGAAACTCAAGCGCACCCTAG
>probe:Drosophila_2:1629243_at:479:123; Interrogation_Position=8086; Antisense; AGCGCACCCTAGATGACTTTCTAAA
>probe:Drosophila_2:1629243_at:471:221; Interrogation_Position=8109; Antisense; AAGTGTCTGATTATTGCGTCCTCGG
>probe:Drosophila_2:1629243_at:148:9; Interrogation_Position=8121; Antisense; ATTGCGTCCTCGGAGCATGTGTACG
>probe:Drosophila_2:1629243_at:59:37; Interrogation_Position=8250; Antisense; ATCTAGTCAACTCAATCGCCATTTA
>probe:Drosophila_2:1629243_at:516:437; Interrogation_Position=8301; Antisense; GAGGACTGTAGAGTTCCCTCTTACT
>probe:Drosophila_2:1629243_at:543:157; Interrogation_Position=8352; Antisense; ACACAGCTCTGATCCTATTCCAAAG

Paste this into a BLAST search page for me
ACACGGACTTTTCATTTCTGGCCAATGGCCAATCTCAATCACTACTATCAGAATCGCCATGTTTACTGCAACTTGAACTTGCCAGTCCAGCAGTTGCAGGTGAAGAAATCCATCGCCACATCTACACATCTACAAGTCCCTGGCATGAGCAAAGGTCAAGTCGAAGCCGCTGCAGAAGTGGAAACTCAAGCGCACCCTAGAGCGCACCCTAGATGACTTTCTAAAAAGTGTCTGATTATTGCGTCCTCGGATTGCGTCCTCGGAGCATGTGTACGATCTAGTCAACTCAATCGCCATTTAGAGGACTGTAGAGTTCCCTCTTACTACACAGCTCTGATCCTATTCCAAAG

Full Affymetrix probeset data:

Annotations for 1629243_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime