FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629246_at:

>probe:Drosophila_2:1629246_at:140:1; Interrogation_Position=1421; Antisense; ACCCGTTTCGATCATTTGTCCCAAT
>probe:Drosophila_2:1629246_at:198:21; Interrogation_Position=1434; Antisense; ATTTGTCCCAATTGCGGTGAGCTTC
>probe:Drosophila_2:1629246_at:679:533; Interrogation_Position=1449; Antisense; GGTGAGCTTCCTGGCCAGAATCATC
>probe:Drosophila_2:1629246_at:329:111; Interrogation_Position=1465; Antisense; AGAATCATCGCTGCCTGAGCAAGCC
>probe:Drosophila_2:1629246_at:563:359; Interrogation_Position=1483; Antisense; GCAAGCCCAAGTACGCATGCGATGT
>probe:Drosophila_2:1629246_at:124:21; Interrogation_Position=1537; Antisense; ATTTGGAGGAGCACTTTGCCACGCA
>probe:Drosophila_2:1629246_at:119:289; Interrogation_Position=1600; Antisense; CGGAATTCCGCTCCAAGTCGAATAT
>probe:Drosophila_2:1629246_at:690:599; Interrogation_Position=1624; Antisense; TGTACCATCACACTAAGCGCAAGCA
>probe:Drosophila_2:1629246_at:171:331; Interrogation_Position=1794; Antisense; GCGGTGCATGCGTAGTCTTAGATCT
>probe:Drosophila_2:1629246_at:35:367; Interrogation_Position=1868; Antisense; GAATGTACTTATCCGACGTTTCGTG
>probe:Drosophila_2:1629246_at:81:479; Interrogation_Position=1885; Antisense; GTTTCGTGTACTCCACAAAGTCAAG
>probe:Drosophila_2:1629246_at:246:317; Interrogation_Position=1920; Antisense; GCCTGGCACCTATTGTGTATACTCT
>probe:Drosophila_2:1629246_at:704:601; Interrogation_Position=1935; Antisense; TGTATACTCTTCTCGTTCTCTATAA
>probe:Drosophila_2:1629246_at:123:275; Interrogation_Position=1952; Antisense; CTCTATAATGCCTTAACCAGTTGGA

Paste this into a BLAST search page for me
ACCCGTTTCGATCATTTGTCCCAATATTTGTCCCAATTGCGGTGAGCTTCGGTGAGCTTCCTGGCCAGAATCATCAGAATCATCGCTGCCTGAGCAAGCCGCAAGCCCAAGTACGCATGCGATGTATTTGGAGGAGCACTTTGCCACGCACGGAATTCCGCTCCAAGTCGAATATTGTACCATCACACTAAGCGCAAGCAGCGGTGCATGCGTAGTCTTAGATCTGAATGTACTTATCCGACGTTTCGTGGTTTCGTGTACTCCACAAAGTCAAGGCCTGGCACCTATTGTGTATACTCTTGTATACTCTTCTCGTTCTCTATAACTCTATAATGCCTTAACCAGTTGGA

Full Affymetrix probeset data:

Annotations for 1629246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720