Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629248_at:

>probe:Drosophila_2:1629248_at:35:419; Interrogation_Position=3809; Antisense; GAGCAGGTCCAATCAAAAGCATACT
>probe:Drosophila_2:1629248_at:122:117; Interrogation_Position=3826; Antisense; AGCATACTGTCCCTAAATGTGCCTT
>probe:Drosophila_2:1629248_at:204:23; Interrogation_Position=3883; Antisense; ATATACACCGATGCGATATCGAGGA
>probe:Drosophila_2:1629248_at:164:395; Interrogation_Position=3910; Antisense; GAAATGTGCTAAACCGTGTACTTAA
>probe:Drosophila_2:1629248_at:626:479; Interrogation_Position=3939; Antisense; GTATTCAACCGCTAACTGTAAGTGT
>probe:Drosophila_2:1629248_at:421:177; Interrogation_Position=3991; Antisense; AAACGTGATGTTGGGCGTTCTGCTT
>probe:Drosophila_2:1629248_at:458:575; Interrogation_Position=4004; Antisense; GGCGTTCTGCTTAATATACTAGGCT
>probe:Drosophila_2:1629248_at:241:413; Interrogation_Position=4053; Antisense; GACCGTTTAATGTGCAGTATTCCAA
>probe:Drosophila_2:1629248_at:519:135; Interrogation_Position=4105; Antisense; ACGAAATTTTAAACTGCAGCCACAA
>probe:Drosophila_2:1629248_at:137:701; Interrogation_Position=4188; Antisense; TTTTGTAAATGTATTGTCCGCCGGG
>probe:Drosophila_2:1629248_at:235:611; Interrogation_Position=4232; Antisense; TGACTTACCACACACCAACGAAATG
>probe:Drosophila_2:1629248_at:240:361; Interrogation_Position=4263; Antisense; GCAAGCAATCCACTCAATTATTTTT
>probe:Drosophila_2:1629248_at:579:701; Interrogation_Position=4285; Antisense; TTTTGTCTAAGCATACAGCAACGAT
>probe:Drosophila_2:1629248_at:367:509; Interrogation_Position=4347; Antisense; GTGCATTTATGCATCATGTATACAG

Paste this into a BLAST search page for me
GAGCAGGTCCAATCAAAAGCATACTAGCATACTGTCCCTAAATGTGCCTTATATACACCGATGCGATATCGAGGAGAAATGTGCTAAACCGTGTACTTAAGTATTCAACCGCTAACTGTAAGTGTAAACGTGATGTTGGGCGTTCTGCTTGGCGTTCTGCTTAATATACTAGGCTGACCGTTTAATGTGCAGTATTCCAAACGAAATTTTAAACTGCAGCCACAATTTTGTAAATGTATTGTCCGCCGGGTGACTTACCACACACCAACGAAATGGCAAGCAATCCACTCAATTATTTTTTTTTGTCTAAGCATACAGCAACGATGTGCATTTATGCATCATGTATACAG

Full Affymetrix probeset data:

Annotations for 1629248_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime