FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629250_at:

>probe:Drosophila_2:1629250_at:452:175; Interrogation_Position=3015; Antisense; AAACCCCACATTTAGTTGATAAGCT
>probe:Drosophila_2:1629250_at:342:83; Interrogation_Position=3060; Antisense; AGGGCATTCGAGTGCCGATCATCGA
>probe:Drosophila_2:1629250_at:62:305; Interrogation_Position=3074; Antisense; CCGATCATCGATGTTGTTGGCATTT
>probe:Drosophila_2:1629250_at:577:343; Interrogation_Position=3093; Antisense; GCATTTATCTTTCCAGAGCCCTGGG
>probe:Drosophila_2:1629250_at:207:321; Interrogation_Position=3110; Antisense; GCCCTGGGCGTATTTGATTTCTTTA
>probe:Drosophila_2:1629250_at:295:489; Interrogation_Position=3152; Antisense; GTACGTATCTATTCATACACTGCAA
>probe:Drosophila_2:1629250_at:197:725; Interrogation_Position=3186; Antisense; TTGCAATGCTCCAAACGAACCCAAG
>probe:Drosophila_2:1629250_at:474:591; Interrogation_Position=3254; Antisense; TGGGATAAAGCTCCCGGTACACCTT
>probe:Drosophila_2:1629250_at:673:537; Interrogation_Position=3269; Antisense; GGTACACCTTTCACACTATCGGACA
>probe:Drosophila_2:1629250_at:620:147; Interrogation_Position=3283; Antisense; ACTATCGGACACATTTACACATAAG
>probe:Drosophila_2:1629250_at:242:179; Interrogation_Position=3308; Antisense; AAACAATGTCAATTTCGTGGAATCA
>probe:Drosophila_2:1629250_at:415:247; Interrogation_Position=3383; Antisense; AATTGCTTAGCTGGACACTTTTCAC
>probe:Drosophila_2:1629250_at:353:333; Interrogation_Position=3392; Antisense; GCTGGACACTTTTCACATCGTAACA
>probe:Drosophila_2:1629250_at:249:9; Interrogation_Position=3482; Antisense; ATTCCATTTTATGTCAGCAGCCCAT

Paste this into a BLAST search page for me
AAACCCCACATTTAGTTGATAAGCTAGGGCATTCGAGTGCCGATCATCGACCGATCATCGATGTTGTTGGCATTTGCATTTATCTTTCCAGAGCCCTGGGGCCCTGGGCGTATTTGATTTCTTTAGTACGTATCTATTCATACACTGCAATTGCAATGCTCCAAACGAACCCAAGTGGGATAAAGCTCCCGGTACACCTTGGTACACCTTTCACACTATCGGACAACTATCGGACACATTTACACATAAGAAACAATGTCAATTTCGTGGAATCAAATTGCTTAGCTGGACACTTTTCACGCTGGACACTTTTCACATCGTAACAATTCCATTTTATGTCAGCAGCCCAT

Full Affymetrix probeset data:

Annotations for 1629250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720