Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629251_at:

>probe:Drosophila_2:1629251_at:46:347; Interrogation_Position=119; Antisense; GCACCTGCACGGGAAAGTACGGATT
>probe:Drosophila_2:1629251_at:530:477; Interrogation_Position=15; Antisense; GTTTTACCACATATCGCTGGAGCAA
>probe:Drosophila_2:1629251_at:637:165; Interrogation_Position=170; Antisense; AAATCGGATCGGGTGTCATCCAGCC
>probe:Drosophila_2:1629251_at:543:15; Interrogation_Position=204; Antisense; ATTTGTGGTGTATCCGGTCAAGTAC
>probe:Drosophila_2:1629251_at:184:205; Interrogation_Position=230; Antisense; AAGCTATCGTCTTTCGGCCATTTAA
>probe:Drosophila_2:1629251_at:662:347; Interrogation_Position=299; Antisense; GCATGTTTGCAGAGATCGGCCCGCT
>probe:Drosophila_2:1629251_at:466:343; Interrogation_Position=329; Antisense; GCTTCATTTCGCATCATTCTATTCC
>probe:Drosophila_2:1629251_at:166:399; Interrogation_Position=358; Antisense; GACATGCAGTTCTGCCCGAATGGGA
>probe:Drosophila_2:1629251_at:535:563; Interrogation_Position=380; Antisense; GGAATCCGCCCTGCTATAAGAGTAA
>probe:Drosophila_2:1629251_at:341:101; Interrogation_Position=39; Antisense; AGAGATTCTGCTTCATCCACGTTAC
>probe:Drosophila_2:1629251_at:706:9; Interrogation_Position=439; Antisense; ATTCGGCTGAAGATTGTGGGCACAC
>probe:Drosophila_2:1629251_at:586:725; Interrogation_Position=491; Antisense; TTGGCACTTTGATGGACGACTACTT
>probe:Drosophila_2:1629251_at:682:401; Interrogation_Position=508; Antisense; GACTACTTGGGATTGGTGTCCAACT
>probe:Drosophila_2:1629251_at:43:377; Interrogation_Position=90; Antisense; GAAGCAGAAACTCTACTCCGAAGTG

Paste this into a BLAST search page for me
GCACCTGCACGGGAAAGTACGGATTGTTTTACCACATATCGCTGGAGCAAAAATCGGATCGGGTGTCATCCAGCCATTTGTGGTGTATCCGGTCAAGTACAAGCTATCGTCTTTCGGCCATTTAAGCATGTTTGCAGAGATCGGCCCGCTGCTTCATTTCGCATCATTCTATTCCGACATGCAGTTCTGCCCGAATGGGAGGAATCCGCCCTGCTATAAGAGTAAAGAGATTCTGCTTCATCCACGTTACATTCGGCTGAAGATTGTGGGCACACTTGGCACTTTGATGGACGACTACTTGACTACTTGGGATTGGTGTCCAACTGAAGCAGAAACTCTACTCCGAAGTG

Full Affymetrix probeset data:

Annotations for 1629251_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime