Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629252_at:

>probe:Drosophila_2:1629252_at:630:151; Interrogation_Position=2067; Antisense; ACACGTAGTGTTCAACTCGTTTCGT
>probe:Drosophila_2:1629252_at:617:281; Interrogation_Position=2082; Antisense; CTCGTTTCGTATTATTCGGGACATA
>probe:Drosophila_2:1629252_at:210:155; Interrogation_Position=2161; Antisense; ACAGAATTCTGGCTTGGTCTTCAAG
>probe:Drosophila_2:1629252_at:293:207; Interrogation_Position=2200; Antisense; AAGCATCCGCTACGAATAAAATATG
>probe:Drosophila_2:1629252_at:287:173; Interrogation_Position=2244; Antisense; AAAGAAATTTAACCCTCATTGAGCA
>probe:Drosophila_2:1629252_at:239:193; Interrogation_Position=2291; Antisense; AACTAGTTCATTTAAGTCATTCCTG
>probe:Drosophila_2:1629252_at:488:497; Interrogation_Position=2306; Antisense; GTCATTCCTGATGTCACTGTTTGTA
>probe:Drosophila_2:1629252_at:315:341; Interrogation_Position=2344; Antisense; GCTAGTTTTGATCCTATTCTTTCAA
>probe:Drosophila_2:1629252_at:240:363; Interrogation_Position=2370; Antisense; GAATGTACAAAGTTCAACGTTTTCG
>probe:Drosophila_2:1629252_at:302:697; Interrogation_Position=2390; Antisense; TTTCGGTTCGTTTAGTTTATGTGCT
>probe:Drosophila_2:1629252_at:105:93; Interrogation_Position=2403; Antisense; AGTTTATGTGCTTGCCTTTGAGGCA
>probe:Drosophila_2:1629252_at:329:399; Interrogation_Position=2458; Antisense; GACAGGATGAAAAAACGCCACAACT
>probe:Drosophila_2:1629252_at:263:311; Interrogation_Position=2474; Antisense; GCCACAACTACATTTATTTTTCCTA
>probe:Drosophila_2:1629252_at:333:485; Interrogation_Position=2525; Antisense; GTATGGCGCAGATACAACGTAATCA

Paste this into a BLAST search page for me
ACACGTAGTGTTCAACTCGTTTCGTCTCGTTTCGTATTATTCGGGACATAACAGAATTCTGGCTTGGTCTTCAAGAAGCATCCGCTACGAATAAAATATGAAAGAAATTTAACCCTCATTGAGCAAACTAGTTCATTTAAGTCATTCCTGGTCATTCCTGATGTCACTGTTTGTAGCTAGTTTTGATCCTATTCTTTCAAGAATGTACAAAGTTCAACGTTTTCGTTTCGGTTCGTTTAGTTTATGTGCTAGTTTATGTGCTTGCCTTTGAGGCAGACAGGATGAAAAAACGCCACAACTGCCACAACTACATTTATTTTTCCTAGTATGGCGCAGATACAACGTAATCA

Full Affymetrix probeset data:

Annotations for 1629252_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime