FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629253_at:

>probe:Drosophila_2:1629253_at:579:293; Interrogation_Position=103; Antisense; CGATTCACCGAGAAATACCTGAGAA
>probe:Drosophila_2:1629253_at:237:27; Interrogation_Position=117; Antisense; ATACCTGAGAACGATGGGCATAGAT
>probe:Drosophila_2:1629253_at:428:345; Interrogation_Position=134; Antisense; GCATAGATGTCAAGGCGCGCAGCGT
>probe:Drosophila_2:1629253_at:629:443; Interrogation_Position=177; Antisense; GATGATGCTGCAGGTCTGGGATACC
>probe:Drosophila_2:1629253_at:600:79; Interrogation_Position=188; Antisense; AGGTCTGGGATACCTCCGGCGACAA
>probe:Drosophila_2:1629253_at:90:131; Interrogation_Position=199; Antisense; ACCTCCGGCGACAAGCGCTTCAATT
>probe:Drosophila_2:1629253_at:215:343; Interrogation_Position=215; Antisense; GCTTCAATTCGCTGATGCCGTCCAA
>probe:Drosophila_2:1629253_at:68:607; Interrogation_Position=227; Antisense; TGATGCCGTCCAATTATCGCAGTGC
>probe:Drosophila_2:1629253_at:304:301; Interrogation_Position=232; Antisense; CCGTCCAATTATCGCAGTGCCCATG
>probe:Drosophila_2:1629253_at:505:565; Interrogation_Position=504; Antisense; GGCAATGGACATATACCATCGTTAT
>probe:Drosophila_2:1629253_at:438:115; Interrogation_Position=518; Antisense; ACCATCGTTATGTACTTCACAACCC
>probe:Drosophila_2:1629253_at:335:475; Interrogation_Position=524; Antisense; GTTATGTACTTCACAACCCGATCAG
>probe:Drosophila_2:1629253_at:131:455; Interrogation_Position=543; Antisense; GATCAGCCCGATGCCATCTGAGCAG
>probe:Drosophila_2:1629253_at:446:321; Interrogation_Position=548; Antisense; GCCCGATGCCATCTGAGCAGGAAGA

Paste this into a BLAST search page for me
CGATTCACCGAGAAATACCTGAGAAATACCTGAGAACGATGGGCATAGATGCATAGATGTCAAGGCGCGCAGCGTGATGATGCTGCAGGTCTGGGATACCAGGTCTGGGATACCTCCGGCGACAAACCTCCGGCGACAAGCGCTTCAATTGCTTCAATTCGCTGATGCCGTCCAATGATGCCGTCCAATTATCGCAGTGCCCGTCCAATTATCGCAGTGCCCATGGGCAATGGACATATACCATCGTTATACCATCGTTATGTACTTCACAACCCGTTATGTACTTCACAACCCGATCAGGATCAGCCCGATGCCATCTGAGCAGGCCCGATGCCATCTGAGCAGGAAGA

Full Affymetrix probeset data:

Annotations for 1629253_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720